RLG00000029787

cwf21 domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
OG0002497
Physical Location & Seq
Forward (+)
49053235 .. 49053942
708 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029787

Sequence Viewer

Length: 387 bp
ATGAAGCATAATAAGACTAGAAACGATGATACTGATGATTCTGCTGCCAGTGAAGATGCCGAGGATAGATCCACAAAGGAAGTCAACAATCCAAACAACCTCGTAGGAGGCATGAATCAGATGATGAATGATACTAATATTGGGAGGAAACCTGCAAGGGTTGAAGAGGGTGATGAAGGACGTGGAAGGCACAACAAGAGTGAACTGCAAAGAGGAAGGAAAAATGAAAGAGATGAAGAGGACCATGATTATAGAAGGCCCAGGGAAGGTCTGGAACAGGAACTTAGAAATAGAAAGCGTGGTACTAGAGAGGAAGAAGGGGCAAATGAGGATATTGAGAGGAATAGACATATGGATTACAGGAGAGCAACATATGATGGAGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
cwf21

Protein Analysis

129

Amino Acids

15.03

Weight (kDa)

5.49

Isoelectric Point (pI)

65.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 160
AclWI GGATC 1 cut(s) 63
AfaI GTAC 1 cut(s) 304
AfiI CCNNNNNNNGG 1 cut(s) 266
AgsI TTSAA 1 cut(s) 164
AjiI CACGTC 1 cut(s) 182
AjnI CCWGG 1 cut(s) 260
AlwI GGATC 1 cut(s) 63
AoxI GGCC 1 cut(s) 257
ApeKI GCWGC 1 cut(s) 44
AspS9I GGNCC 2 cut(s) 241, 258
AsuHPI GGTGA 1 cut(s) 182
AvaII GGWCC 1 cut(s) 241
BbvI GCAGC 1 cut(s) 31
BccI CCATC 1 cut(s) 371
BciT130I CCWGG 1 cut(s) 262
BfaI CTAG 3 cut(s) 18, 306, 385
BfuAI ACCTGC 1 cut(s) 160
BisI GCNGC 1 cut(s) 45
BlsI GCNGC 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 262
Bme18I GGWCC 1 cut(s) 241
BmgBI CACGTC 1 cut(s) 182
BmgT120I GGNCC 2 cut(s) 241, 258
BmrFI CCNGG 1 cut(s) 262
BmsI GCATC 1 cut(s) 46
BsaJI CCNNGG 3 cut(s) 60, 260, 261
Bsc4I CCNNNNNNNGG 1 cut(s) 266
Bse1I ACTGG 1 cut(s) 48
BseBI CCWGG 1 cut(s) 262
BseDI CCNNGG 3 cut(s) 60, 260, 261
BseLI CCNNNNNNNGG 1 cut(s) 266
BseNI ACTGG 1 cut(s) 48
BseXI GCAGC 1 cut(s) 31
BshFI GGCC 1 cut(s) 259
BslI CCNNNNNNNGG 1 cut(s) 266
BsnI GGCC 1 cut(s) 259
Bsp143I GATC 1 cut(s) 68
BspANI GGCC 1 cut(s) 259
BspMI ACCTGC 1 cut(s) 160
BspPI GGATC 1 cut(s) 63
BsrI ACTGG 1 cut(s) 48
BssECI CCNNGG 3 cut(s) 60, 260, 261
BssMI GATC 1 cut(s) 68
Bst2UI CCWGG 1 cut(s) 262
Bst6I CTCTTC 2 cut(s) 159, 231
BstDEI CTNAG 1 cut(s) 284
BstKTI GATC 1 cut(s) 71
BstMBI GATC 1 cut(s) 68
BstNI CCWGG 1 cut(s) 262
BstSCI CCNGG 1 cut(s) 260
BstV1I GCAGC 1 cut(s) 31
BstX2I RGATCY 1 cut(s) 68
BstYI RGATCY 1 cut(s) 68
BsuRI GGCC 1 cut(s) 259
BtrI CACGTC 1 cut(s) 182
BtsIMutI CAGTG 1 cut(s) 55
BveI ACCTGC 1 cut(s) 160
Cfr13I GGNCC 2 cut(s) 241, 258
Csp6I GTAC 1 cut(s) 303
CviAII CATG 2 cut(s) 112, 245
CviJI RGCY 1 cut(s) 259
CviKI_1 RGCY 1 cut(s) 259
CviQI GTAC 1 cut(s) 303
DdeI CTNAG 1 cut(s) 284
DpnI GATC 1 cut(s) 70
DpnII GATC 1 cut(s) 68
Eam1104I CTCTTC 2 cut(s) 159, 231
EarI CTCTTC 2 cut(s) 159, 231
Eco47I GGWCC 1 cut(s) 241
EcoRII CCWGG 1 cut(s) 260
FaeI CATG 2 cut(s) 115, 248
FaiI YATR 8 cut(s) 9, 113, 246, 252, 351, 353, 373, 375
FatI CATG 2 cut(s) 111, 244
FauNDI CATATG 2 cut(s) 351, 373
Fnu4HI GCNGC 1 cut(s) 45
Fsp4HI GCNGC 1 cut(s) 45
FspBI CTAG 3 cut(s) 18, 306, 385
GluI GCNGC 1 cut(s) 45
HaeIII GGCC 1 cut(s) 259
Hin1II CATG 2 cut(s) 115, 248
HincII GTYRAC 1 cut(s) 85
HindII GTYRAC 1 cut(s) 85
HinfI GANTC 3 cut(s) 38, 115, 381
HphI GGTGA 1 cut(s) 182
Hpy166II GTNNAC 2 cut(s) 85, 203
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 272
Hpy8I GTNNAC 2 cut(s) 85, 203
HpyAV CCTTC 6 cut(s) 170, 180, 210, 249, 260, 311
HpyCH4IV ACGT 1 cut(s) 181
HpyCH4V TGCA 2 cut(s) 155, 208
HpyF3I CTNAG 1 cut(s) 284
HpySE526I ACGT 1 cut(s) 181
Hsp92II CATG 2 cut(s) 115, 248
Kzo9I GATC 1 cut(s) 68
LpnPI CCDG 7 cut(s) 61, 165, 247, 257, 263, 274, 346
Lsp1109I GCAGC 1 cut(s) 31
LweI GCATC 1 cut(s) 46
MaeI CTAG 3 cut(s) 18, 306, 385
MaeII ACGT 1 cut(s) 181
MalI GATC 1 cut(s) 70
MboI GATC 1 cut(s) 68
MboII GAAGA 4 cut(s) 65, 176, 248, 326
MflI RGATCY 1 cut(s) 68
MspR9I CCNGG 1 cut(s) 262
MvaI CCWGG 1 cut(s) 262
NdeI CATATG 2 cut(s) 351, 373
NdeII GATC 1 cut(s) 68
NlaIII CATG 2 cut(s) 115, 248
NmeAIII GCCGAG 1 cut(s) 85
PasI CCCWGGG 1 cut(s) 261
PfeI GAWTC 2 cut(s) 38, 115
PkrI GCNGC 1 cut(s) 46
Psp6I CCWGG 1 cut(s) 260
PspGI CCWGG 1 cut(s) 260
PspPI GGNCC 2 cut(s) 241, 258
PsuI RGATCY 1 cut(s) 68
RsaI GTAC 1 cut(s) 304
RsaNI GTAC 1 cut(s) 303
SatI GCNGC 1 cut(s) 45
Sau3AI GATC 1 cut(s) 68
Sau96I GGNCC 2 cut(s) 241, 258
ScrFI CCNGG 1 cut(s) 262
SetI ASST 4 cut(s) 102, 154, 184, 271
SfaNI GCATC 1 cut(s) 46
SinI GGWCC 1 cut(s) 241
SspI AATATT 1 cut(s) 139
SspMI CTAG 3 cut(s) 18, 306, 385
StyD4I CCNGG 1 cut(s) 260
TaiI ACGT 1 cut(s) 184
TfiI GAWTC 2 cut(s) 38, 115
TscAI CASTG 1 cut(s) 55
TseI GCWGC 1 cut(s) 44
TspDTI ATGAA 6 cut(s) 17, 128, 140, 189, 240, 249
TspRI CASTG 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 241
XcmI CCANNNNNNNNNTGG 1 cut(s) 268
XspI CTAG 3 cut(s) 18, 306, 385
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.