MD15G1111000.v1.1

cwf21 domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0002497
Physical Location & Seq
Reverse (-)
7748424 .. 7749458
1035 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1111000.v1.1.491

Sequence Viewer

Length: 534 bp
ATGGGAAAGAGACAGAAGGTTGCAAAAAAGAATGAGAAAAGAAGAAATAAGAACTCCGATGATTCTGATTTTGCTTCGAGTGATGATGATGCCAGGAGCAACGATGCAAAAATGAAAGTTCAGAAATTCAAAAAACCTCAAAGGAGGCACGATTCAGATGAAGATGATTCTGAAGCTGATGTTGGCAGGAGGCAGAAGGTTGTTAAGAAACATAGTAGGAGCAGAAGGGATGACACTGACTATTCCAATTCTTCTACCAGCGGTGATGATGCTAGGAGGGACAGTTCGAAAAAGCAAGTTGAGAAATTCAAAAAAGCTACTAGTGATGATGAAGCTATGAGGGACAGATCAAGAAAGGAAGTTGAGATATTCAAAAAACCTCAAAGGAGGCATGACTCAGTTGAAGATGATTCTGAAGCTGATGTTGGAAAAAAGCAGAAGGTTGAAAAGAAGCATAGTAAAAGTAGAAAGGATATGATTCTGATTCCGCTAACAGTGATGATGGTGCTGAGGACAGATCCAGAAAGGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
cwf21

Protein Analysis

178

Amino Acids

20.68

Weight (kDa)

9.79

Isoelectric Point (pI)

65.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 261, 488
AclWI GGATC 1 cut(s) 512
AcsI RAATTY 2 cut(s) 125, 305
AcuI CTGAAG 2 cut(s) 192, 435
AgsI TTSAA 5 cut(s) 130, 310, 373, 404, 446
AhlI ACTAGT 1 cut(s) 320
AjnI CCWGG 1 cut(s) 92
AjuI GAANNNNNNNTTGG 4 cut(s) 165, 197, 408, 440
AloI GAACNNNNNNTCC 2 cut(s) 268, 300
AluBI AGCT 4 cut(s) 176, 317, 335, 419
AluI AGCT 4 cut(s) 176, 317, 335, 419
Alw26I GTCTC 1 cut(s) 4
AlwI GGATC 1 cut(s) 512
ApoI RAATTY 2 cut(s) 125, 305
AsuHPI GGTGA 1 cut(s) 275
AsuII TTCGAA 1 cut(s) 287
BbvCI CCTCAGC 1 cut(s) 509
BccI CCATC 1 cut(s) 496
BciT130I CCWGG 1 cut(s) 94
BcoDI GTCTC 1 cut(s) 4
BcuI ACTAGT 1 cut(s) 320
BfaI CTAG 2 cut(s) 273, 321
Bme1390I CCNGG 1 cut(s) 94
BmrFI CCNGG 1 cut(s) 94
BmsI GCATC 3 cut(s) 79, 94, 259
Bpu10I CCTNAGC 1 cut(s) 509
Bpu14I TTCGAA 1 cut(s) 287
BsaXI ACNNNNNCTCC 2 cut(s) 268, 298
BseBI CCWGG 1 cut(s) 94
BseGI GGATG 1 cut(s) 235
BseMII CTCAG 2 cut(s) 411, 500
BslFI GGGAC 2 cut(s) 293, 356
BsmAI GTCTC 1 cut(s) 4
BsmFI GGGAC 2 cut(s) 293, 356
Bsp119I TTCGAA 1 cut(s) 287
Bsp143I GATC 2 cut(s) 347, 517
BspACI CCGC 2 cut(s) 261, 488
BspCNI CTCAG 2 cut(s) 410, 501
BspPI GGATC 1 cut(s) 512
BspT104I TTCGAA 1 cut(s) 287
BssMI GATC 2 cut(s) 347, 517
Bst2UI CCWGG 1 cut(s) 94
Bst4CI ACNGT 2 cut(s) 284, 496
BstBI TTCGAA 1 cut(s) 287
BstDEI CTNAG 2 cut(s) 397, 509
BstF5I GGATG 1 cut(s) 235
BstKTI GATC 2 cut(s) 350, 520
BstMAI GTCTC 1 cut(s) 4
BstMBI GATC 2 cut(s) 347, 517
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 92
BstX2I RGATCY 1 cut(s) 517
BstYI RGATCY 1 cut(s) 517
BtsCI GGATG 1 cut(s) 235
BtsIMutI CAGTG 2 cut(s) 234, 501
CviAII CATG 1 cut(s) 392
CviJI RGCY 4 cut(s) 176, 317, 335, 419
CviKI_1 RGCY 4 cut(s) 176, 317, 335, 419
DdeI CTNAG 2 cut(s) 397, 509
DpnI GATC 2 cut(s) 349, 519
DpnII GATC 2 cut(s) 347, 517
Eco57I CTGAAG 2 cut(s) 192, 435
EcoRII CCWGG 1 cut(s) 92
FaeI CATG 1 cut(s) 395
FaiI YATR 5 cut(s) 213, 338, 393, 456, 476
FaqI GGGAC 2 cut(s) 293, 356
FatI CATG 1 cut(s) 391
FokI GGATG 1 cut(s) 242
FspBI CTAG 2 cut(s) 273, 321
Hin1II CATG 1 cut(s) 395
HinfI GANTC 7 cut(s) 62, 152, 167, 395, 410, 478, 484
HphI GGTGA 1 cut(s) 275
Hpy188I TCNGA 7 cut(s) 58, 67, 123, 157, 172, 415, 483
Hpy188III TCNNGA 2 cut(s) 351, 521
HpyAV CCTTC 4 cut(s) 10, 190, 219, 433
HpyCH4III ACNGT 2 cut(s) 284, 496
HpyCH4V TGCA 2 cut(s) 23, 107
HpyF3I CTNAG 2 cut(s) 397, 509
Hsp92II CATG 1 cut(s) 395
Kzo9I GATC 2 cut(s) 347, 517
LmnI GCTCC 2 cut(s) 96, 219
LpnPI CCDG 4 cut(s) 79, 106, 172, 271
LweI GCATC 3 cut(s) 79, 94, 259
MaeI CTAG 2 cut(s) 273, 321
MalI GATC 2 cut(s) 349, 519
MboI GATC 2 cut(s) 347, 517
MboII GAAGA 4 cut(s) 54, 173, 243, 416
MflI RGATCY 1 cut(s) 517
MluCI AATT 3 cut(s) 125, 247, 305
MlyI GAGTC 1 cut(s) 389
MmeI TCCRAC 1 cut(s) 406
MnlI CCTC 8 cut(s) 138, 147, 183, 270, 333, 381, 390, 504
MseI TTAA 1 cut(s) 204
MspA1I CMGCKG 1 cut(s) 261
MspR9I CCNGG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 94
NdeII GATC 2 cut(s) 347, 517
NlaIII CATG 1 cut(s) 395
NspV TTCGAA 1 cut(s) 287
PfeI GAWTC 6 cut(s) 62, 152, 167, 410, 478, 484
PleI GAGTC 1 cut(s) 389
PpsI GAGTC 1 cut(s) 389
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PsuI RGATCY 1 cut(s) 517
SaqAI TTAA 1 cut(s) 204
Sau3AI GATC 2 cut(s) 347, 517
SchI GAGTC 1 cut(s) 389
ScrFI CCNGG 1 cut(s) 94
SetI ASST 9 cut(s) 21, 139, 178, 201, 319, 337, 382, 421, 444
SfaNI GCATC 3 cut(s) 79, 94, 259
SfuI TTCGAA 1 cut(s) 287
SpeI ACTAGT 1 cut(s) 320
Sse9I AATT 3 cut(s) 125, 247, 305
SsiI CCGC 2 cut(s) 261, 488
SspMI CTAG 2 cut(s) 273, 321
StyD4I CCNGG 1 cut(s) 92
TaaI ACNGT 2 cut(s) 284, 496
TaqI TCGA 2 cut(s) 77, 287
TasI AATT 3 cut(s) 125, 247, 305
TfiI GAWTC 6 cut(s) 62, 152, 167, 410, 478, 484
Tru1I TTAA 1 cut(s) 204
Tru9I TTAA 1 cut(s) 204
TscAI CASTG 2 cut(s) 241, 501
TspDTI ATGAA 3 cut(s) 128, 174, 345
TspRI CASTG 2 cut(s) 241, 501
XapI RAATTY 2 cut(s) 125, 305
XspI CTAG 2 cut(s) 273, 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.