RLG00000029803

cwf21 domain

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
49478253 .. 49478980
728 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000029803

Sequence Viewer

Length: 579 bp
ATGATGCGAAGGGCAGATCCAGAAAGGAAATTAAGAAATCCAAGCGACGTCATAGGAGGGCATGATTCAGATGAAGATGATTCTGAAGATGATGTTGACAAGAAGAGGAAGGTTGTAATGAAGCATGATAAGACTAGAAACAATGATACTGATGATTCTGCTGCCAATGAAGATGCCGAGGATAGATCCACAAAGGAAGTCAAGAATCCAAACAACCTCGTAGGAGCCATGAATCAAATAATGTCTCTGGTCAGCCATAGGGTAGATCGAGATGATTTTGATATGGAGAAGGCTGACAATGTTAGAAGTGGAAAAAGCATAAAATCATATGATAGTGATTCTATTTCTGACTATGAAAGATCCAGAAAAAGTAGAGGTGCAATAACAGAAAAAAGTAGAAGAAGTGGCAGGAATGATACTAATGATGATATTACTAATATTGGGAGGAAACCTGCAAGGGTTGAAGAGTGTGATGGAGGACGTGGAAGGCACAACAAGAATGAACTGCAAAGAGGAAGGAAAAATGAAAGAAATGAAGAGGATCATGATTATAGAAGGCCCAAGGAAGGTCTGGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

193

Amino Acids

22.1

Weight (kDa)

5.85

Isoelectric Point (pI)

56.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 51
Acc36I ACCTGC 1 cut(s) 460
AclWI GGATC 4 cut(s) 11, 180, 354, 549
AcuI CTGAAG 1 cut(s) 105
AcyI GRCGYC 1 cut(s) 48
AfiI CCNNNNNNNGG 1 cut(s) 566
AgsI TTSAA 1 cut(s) 464
AjiI CACGTC 1 cut(s) 482
Alw26I GTCTC 1 cut(s) 249
AlwI GGATC 4 cut(s) 11, 180, 354, 549
AoxI GGCC 1 cut(s) 557
ApeKI GCWGC 1 cut(s) 161
AspS9I GGNCC 1 cut(s) 558
BbvI GCAGC 1 cut(s) 148
BccI CCATC 1 cut(s) 467
BcoDI GTCTC 1 cut(s) 249
BfaI CTAG 1 cut(s) 135
BfuAI ACCTGC 1 cut(s) 460
BisI GCNGC 1 cut(s) 162
BlsI GCNGC 1 cut(s) 163
BmgBI CACGTC 1 cut(s) 482
BmgT120I GGNCC 1 cut(s) 558
BmiI GGNNCC 1 cut(s) 226
BmsI GCATC 1 cut(s) 163
BsaHI GRCGYC 1 cut(s) 48
BsaJI CCNNGG 2 cut(s) 177, 561
Bsc4I CCNNNNNNNGG 1 cut(s) 566
BseDI CCNNGG 2 cut(s) 177, 561
BseLI CCNNNNNNNGG 1 cut(s) 566
BseXI GCAGC 1 cut(s) 148
BshFI GGCC 1 cut(s) 559
BslI CCNNNNNNNGG 1 cut(s) 566
BsmAI GTCTC 1 cut(s) 249
BsnI GGCC 1 cut(s) 559
Bsp143I GATC 5 cut(s) 16, 185, 265, 359, 541
BspANI GGCC 1 cut(s) 559
BspHI TCATGA 1 cut(s) 544
BspLI GGNNCC 1 cut(s) 226
BspMI ACCTGC 1 cut(s) 460
BspPI GGATC 4 cut(s) 11, 180, 354, 549
BssECI CCNNGG 2 cut(s) 177, 561
BssMI GATC 5 cut(s) 16, 185, 265, 359, 541
BssNI GRCGYC 1 cut(s) 48
BssT1I CCWWGG 1 cut(s) 561
Bst6I CTCTTC 3 cut(s) 98, 459, 531
BstACI GRCGYC 1 cut(s) 48
BstKTI GATC 5 cut(s) 19, 188, 268, 362, 544
BstMAI GTCTC 1 cut(s) 249
BstMBI GATC 5 cut(s) 16, 185, 265, 359, 541
BstV1I GCAGC 1 cut(s) 148
BstX2I RGATCY 3 cut(s) 16, 185, 359
BstYI RGATCY 3 cut(s) 16, 185, 359
BsuRI GGCC 1 cut(s) 559
BtrI CACGTC 1 cut(s) 482
BveI ACCTGC 1 cut(s) 460
CciI TCATGA 1 cut(s) 544
Cfr13I GGNCC 1 cut(s) 558
CviAII CATG 4 cut(s) 62, 125, 229, 545
CviJI RGCY 4 cut(s) 227, 255, 293, 559
CviKI_1 RGCY 4 cut(s) 227, 255, 293, 559
DpnI GATC 5 cut(s) 18, 187, 267, 361, 543
DpnII GATC 5 cut(s) 16, 185, 265, 359, 541
Eam1104I CTCTTC 3 cut(s) 98, 459, 531
EarI CTCTTC 3 cut(s) 98, 459, 531
Eco130I CCWWGG 1 cut(s) 561
Eco57I CTGAAG 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 561
ErhI CCWWGG 1 cut(s) 561
FaeI CATG 4 cut(s) 65, 128, 232, 548
FatI CATG 4 cut(s) 61, 124, 228, 544
FauNDI CATATG 1 cut(s) 328
Fnu4HI GCNGC 1 cut(s) 162
Fsp4HI GCNGC 1 cut(s) 162
FspBI CTAG 1 cut(s) 135
GluI GCNGC 1 cut(s) 162
HaeIII GGCC 1 cut(s) 559
Hin1I GRCGYC 1 cut(s) 48
Hin1II CATG 4 cut(s) 65, 128, 232, 548
HincII GTYRAC 1 cut(s) 97
HindII GTYRAC 1 cut(s) 97
HinfI GANTC 6 cut(s) 65, 80, 155, 205, 232, 338
Hpy166II GTNNAC 1 cut(s) 97
Hpy188I TCNGA 3 cut(s) 70, 85, 349
Hpy188III TCNNGA 6 cut(s) 20, 202, 269, 363, 545, 572
Hpy8I GTNNAC 1 cut(s) 97
Hpy99I CGWCG 1 cut(s) 50
HpyAV CCTTC 7 cut(s) 3, 103, 283, 480, 510, 549, 560
HpyCH4IV ACGT 2 cut(s) 48, 481
HpyCH4V TGCA 3 cut(s) 380, 455, 508
HpySE526I ACGT 2 cut(s) 48, 481
Hsp92I GRCGYC 1 cut(s) 48
Hsp92II CATG 4 cut(s) 65, 128, 232, 548
Kzo9I GATC 5 cut(s) 16, 185, 265, 359, 541
LmnI GCTCC 1 cut(s) 224
LpnPI CCDG 6 cut(s) 33, 233, 376, 394, 465, 557
Lsp1109I GCAGC 1 cut(s) 148
LweI GCATC 1 cut(s) 163
MaeI CTAG 1 cut(s) 135
MaeII ACGT 2 cut(s) 48, 481
MalI GATC 5 cut(s) 18, 187, 267, 361, 543
MboI GATC 5 cut(s) 16, 185, 265, 359, 541
MboII GAAGA 7 cut(s) 86, 98, 115, 182, 411, 476, 548
MflI RGATCY 3 cut(s) 16, 185, 359
MluCI AATT 1 cut(s) 29
MnlI CCTC 9 cut(s) 50, 99, 172, 227, 368, 438, 470, 506, 532
MseI TTAA 1 cut(s) 32
NdeI CATATG 1 cut(s) 328
NdeII GATC 5 cut(s) 16, 185, 265, 359, 541
NlaIII CATG 4 cut(s) 65, 128, 232, 548
NlaIV GGNNCC 1 cut(s) 226
NmeAIII GCCGAG 1 cut(s) 202
PagI TCATGA 1 cut(s) 544
PfeI GAWTC 6 cut(s) 65, 80, 155, 205, 232, 338
PkrI GCNGC 1 cut(s) 163
PspN4I GGNNCC 1 cut(s) 226
PspPI GGNCC 1 cut(s) 558
PsuI RGATCY 3 cut(s) 16, 185, 359
SaqAI TTAA 1 cut(s) 32
SatI GCNGC 1 cut(s) 162
Sau3AI GATC 5 cut(s) 16, 185, 265, 359, 541
Sau96I GGNCC 1 cut(s) 558
SetI ASST 7 cut(s) 51, 114, 219, 379, 454, 484, 571
SfaNI GCATC 1 cut(s) 163
Sse9I AATT 1 cut(s) 29
SspI AATATT 1 cut(s) 439
SspMI CTAG 1 cut(s) 135
StyI CCWWGG 1 cut(s) 561
TaiI ACGT 2 cut(s) 51, 484
TaqI TCGA 1 cut(s) 268
TasI AATT 1 cut(s) 29
TfiI GAWTC 6 cut(s) 65, 80, 155, 205, 232, 338
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TseI GCWGC 1 cut(s) 161
TspDTI ATGAA 8 cut(s) 87, 134, 183, 245, 369, 516, 540, 549
XcmI CCANNNNNNNNNTGG 1 cut(s) 568
XspI CTAG 1 cut(s) 135
ZraI GACGTC 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.