Prupe.1G562200_v2.0.a1

Basic blue

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
45938600 .. 45939620
1021 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G562200.1

Sequence Viewer

Length: 261 bp
ATGAGCCAAGCTAGAGGCAGTGCAATTGTTGCCACAACGTTATTGTTGTCTTGTTGTGAGATTAGTGATGCGACCAACTACACCGTTGGAGGTGATGATGGTTGGAACTTTAAAGTCCATGACTGGCCTACTGGCAAGAAATTCCACACTCACGATACATTGGTGTTCAAATACAATAATGGACAGGACAATGTGGTGGTGGTAGATGAAAATGGTTACACAACATGCACAATAGGCGACCAAGTTCTCATCAGGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.48

Weight (kDa)

5.36

Isoelectric Point (pI)

8.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 38
AcsI RAATTY 1 cut(s) 140
AgsI TTSAA 1 cut(s) 169
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
AoxI GGCC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 140
AsuHPI GGTGA 1 cut(s) 104
BaeI ACNNNNGTAYC 2 cut(s) 147, 180
BccI CCATC 1 cut(s) 92
BfaI CTAG 1 cut(s) 12
BmsI GCATC 1 cut(s) 58
Bse1I ACTGG 2 cut(s) 128, 136
BseNI ACTGG 2 cut(s) 128, 136
BshFI GGCC 1 cut(s) 127
BsnI GGCC 1 cut(s) 127
BspANI GGCC 1 cut(s) 127
BsrI ACTGG 2 cut(s) 128, 136
Bst4CI ACNGT 1 cut(s) 85
BstAPI GCANNNNNTGC 1 cut(s) 29
BstMWI GCNNNNNNNGC 2 cut(s) 29, 234
BstNSI RCATGY 1 cut(s) 228
BsuRI GGCC 1 cut(s) 127
BtsI GCAGTG 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 25
CviAII CATG 2 cut(s) 119, 225
CviJI RGCY 3 cut(s) 6, 11, 127
CviKI_1 RGCY 3 cut(s) 6, 11, 127
DraI TTTAAA 1 cut(s) 112
FaeI CATG 2 cut(s) 122, 228
FaiI YATR 2 cut(s) 120, 226
FatI CATG 2 cut(s) 118, 224
FspBI CTAG 1 cut(s) 12
HaeIII GGCC 1 cut(s) 127
Hin1II CATG 2 cut(s) 122, 228
HphI GGTGA 1 cut(s) 104
Hpy188III TCNNGA 2 cut(s) 152, 253
HpyCH4III ACNGT 1 cut(s) 85
HpyCH4IV ACGT 1 cut(s) 38
HpyCH4V TGCA 2 cut(s) 23, 228
HpyF10VI GCNNNNNNNGC 2 cut(s) 29, 234
HpySE526I ACGT 1 cut(s) 38
Hsp92II CATG 2 cut(s) 122, 228
LpnPI CCDG 4 cut(s) 109, 117, 170, 238
LweI GCATC 1 cut(s) 58
MaeI CTAG 1 cut(s) 12
MaeII ACGT 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 215
MfeI CAATTG 1 cut(s) 24
MluCI AATT 2 cut(s) 24, 140
MmeI TCCRAC 2 cut(s) 67, 83
MnlI CCTC 2 cut(s) 8, 83
MseI TTAA 1 cut(s) 111
MunI CAATTG 1 cut(s) 24
MwoI GCNNNNNNNGC 2 cut(s) 29, 234
NlaIII CATG 2 cut(s) 122, 228
NspI RCATGY 1 cut(s) 228
Psp1406I AACGTT 1 cut(s) 38
SaqAI TTAA 1 cut(s) 111
SetI ASST 3 cut(s) 13, 41, 94
SfaNI GCATC 1 cut(s) 58
Sse9I AATT 2 cut(s) 24, 140
SspMI CTAG 1 cut(s) 12
TaaI ACNGT 1 cut(s) 85
TaiI ACGT 1 cut(s) 41
TasI AATT 2 cut(s) 24, 140
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TscAI CASTG 1 cut(s) 25
TspDTI ATGAA 1 cut(s) 222
TspRI CASTG 1 cut(s) 25
XapI RAATTY 1 cut(s) 140
XceI RCATGY 1 cut(s) 228
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.