Prupe.4G098000_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
4979129 .. 4979383
255 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G098000.1

Sequence Viewer

Length: 162 bp
ATGAACCAATACGGTACTGTTACATCATTAAGGAACCCCATGTCCTTATTTACATATCAAGAATCAAGGACCCTCAAGTCCGATCACATGTTTACAAATATAGTACTGGAGAGACTGCTAGCTCTCATATCAATATCATCATCAAGGATCTTCAAGTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.13

Weight (kDa)

9.98

Isoelectric Point (pI)

35.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 76
AclWI GGATC 1 cut(s) 155
AfaI GTAC 2 cut(s) 16, 105
AflIII ACRYGT 1 cut(s) 87
AgsI TTSAA 1 cut(s) 154
AloI GAACNNNNNNTCC 2 cut(s) 26, 58
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
Alw26I GTCTC 1 cut(s) 106
AlwI GGATC 1 cut(s) 155
AspS9I GGNCC 1 cut(s) 69
AsuNHI GCTAGC 1 cut(s) 118
AvaII GGWCC 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 106
BfaI CTAG 1 cut(s) 119
BmcAI AGTACT 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 69
BmgT120I GGNCC 1 cut(s) 69
BmiI GGNNCC 2 cut(s) 35, 71
BmtI GCTAGC 1 cut(s) 122
BpmI CTGGAG 1 cut(s) 128
BpuEI CTTGAG 1 cut(s) 59
Bse1I ACTGG 1 cut(s) 111
BseNI ACTGG 1 cut(s) 111
BsmAI GTCTC 1 cut(s) 106
Bsp143I GATC 2 cut(s) 82, 147
BspLI GGNNCC 2 cut(s) 35, 71
BspOI GCTAGC 1 cut(s) 122
BspPI GGATC 1 cut(s) 155
BsrI ACTGG 1 cut(s) 111
BssMI GATC 2 cut(s) 82, 147
Bst4CI ACNGT 2 cut(s) 14, 19
BstC8I GCNNGC 1 cut(s) 120
BstKTI GATC 2 cut(s) 85, 150
BstMAI GTCTC 1 cut(s) 106
BstMBI GATC 2 cut(s) 82, 147
BstNSI RCATGY 1 cut(s) 91
BstX2I RGATCY 1 cut(s) 147
BstYI RGATCY 1 cut(s) 147
Cac8I GCNNGC 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 69
Csp6I GTAC 2 cut(s) 15, 104
CviAII CATG 2 cut(s) 40, 88
CviJI RGCY 1 cut(s) 122
CviKI_1 RGCY 1 cut(s) 122
CviQI GTAC 2 cut(s) 15, 104
DpnI GATC 2 cut(s) 84, 149
DpnII GATC 2 cut(s) 82, 147
DrdI GACNNNNNNGTC 1 cut(s) 76
DseDI GACNNNNNNGTC 1 cut(s) 76
Eco47I GGWCC 1 cut(s) 69
EcoO109I RGGNCCY 1 cut(s) 69
FaeI CATG 2 cut(s) 43, 91
FaiI YATR 5 cut(s) 41, 55, 89, 101, 128
FatI CATG 2 cut(s) 39, 87
FspBI CTAG 1 cut(s) 119
GsuI CTGGAG 1 cut(s) 128
Hin1II CATG 2 cut(s) 43, 91
HinfI GANTC 1 cut(s) 62
Hpy166II GTNNAC 1 cut(s) 93
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 2 cut(s) 59, 159
Hpy8I GTNNAC 1 cut(s) 93
HpyCH4III ACNGT 2 cut(s) 14, 19
Hsp92II CATG 2 cut(s) 43, 91
Kzo9I GATC 2 cut(s) 82, 147
LpnPI CCDG 1 cut(s) 92
MaeI CTAG 1 cut(s) 119
MaeIII GTNAC 1 cut(s) 19
MalI GATC 2 cut(s) 84, 149
MboI GATC 2 cut(s) 82, 147
MboII GAAGA 1 cut(s) 142
MflI RGATCY 1 cut(s) 147
MnlI CCTC 1 cut(s) 83
MseI TTAA 1 cut(s) 29
NdeII GATC 2 cut(s) 82, 147
NheI GCTAGC 1 cut(s) 118
NlaIII CATG 2 cut(s) 43, 91
NlaIV GGNNCC 2 cut(s) 35, 71
NspI RCATGY 1 cut(s) 91
PciI ACATGT 1 cut(s) 87
PfeI GAWTC 1 cut(s) 62
PpuMI RGGWCCY 1 cut(s) 69
PscI ACATGT 1 cut(s) 87
Psp5II RGGWCCY 1 cut(s) 69
PspN4I GGNNCC 2 cut(s) 35, 71
PspPI GGNCC 1 cut(s) 69
PspPPI RGGWCCY 1 cut(s) 69
PsuI RGATCY 1 cut(s) 147
RsaI GTAC 2 cut(s) 16, 105
RsaNI GTAC 2 cut(s) 15, 104
SaqAI TTAA 1 cut(s) 29
Sau3AI GATC 2 cut(s) 82, 147
Sau96I GGNCC 1 cut(s) 69
ScaI AGTACT 1 cut(s) 105
SetI ASST 1 cut(s) 124
SgeI CNNG 8 cut(s) 52, 71, 78, 88, 100, 119, 131, 156
SinI GGWCC 1 cut(s) 69
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
SspMI CTAG 1 cut(s) 119
TaaI ACNGT 2 cut(s) 14, 19
TatI WGTACW 1 cut(s) 103
TfiI GAWTC 1 cut(s) 62
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 69
XceI RCATGY 1 cut(s) 91
XspI CTAG 1 cut(s) 119
ZrmI AGTACT 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.