Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006147.1

Orthogroup ID

OG0006631

Physical Location & Seq

Genomic Coordinates Forward (+)

17826 .. 18506

Gene Structure 681 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006147.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 531 bp

ctgactgctgctgataaggtgtcggggctgtctcagctttcaaaccctgaggcagagtccgttcttattactaggacttcagtgccacaacatgcttatcaggcatttgaactgctgagtcgaagtactgaggctcagaatgttgttgcttcgattgcaagtgacccaaatatctggaatgctatgatggaaaattctgcggtcaaacaattcatggagtctcaacaaaacataaattatgatcggtatgaatctgcttcagattcagaggttttcaatcccgtatcatctaaggagatcgtagaggaacatgattcaagccaatcttctgacctggaacgtctgttcaatggttttgtggataaagtcaagcttactgtcaataccattgtcagcaatttgtcgacatacattcaaagcatttttggaccccctgcagatgacaatgggcctaccagaactgcaataacatctgggttcatgggactggcagttatggttgtaatggtggttttgctgaagcgtgcctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

176

Amino Acids

19.23

Weight (kDa)

4.6

Isoelectric Point (pI)

42.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006631)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G54540
fragaria_vesca	FvH4_3g21510
malus_domestica	MD03G1215500.v1.1 MD11G1230100.v1.1
prunus_persica	Prupe.4G098000_v2.0.a1 Prupe.4G197300_v2.0.a1 Prupe.5G070000_v2.0.a1
pyrus_communis	pycom03g16390 pycom10g14480 pycom11g20390
rosa_chinensis	RchiOBHm_Chr5g0036951
rosa_laevigata	RLG00000011241 RLG00000033738
rosa_multiflora	Rmu_sc0006147.1_g000006 Rmu_sc0007663.1_g000019
rosa_roxburghii	Rroxscaffold_1G00044010 Rroxscaffold_7G00166630
rosa_rugosa	Rorug05G0159300 Rorug06G0306700
rosa_samantha	Rh5AG251500 Rh5BG252900 Rh5CG285500 Rh5DG261600 Rh6BG426000 Rh6DG419300
rosa_wichuraiana	Rw5G023150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	404
AciI	CCGC	1 cut(s)	200
AcsI	RAATTY	1 cut(s)	193
AcuI	CTGAAG	2 cut(s)	63, 243
AfaI	GTAC	1 cut(s)	127
AgsI	TTSAA	6 cut(s)	42, 110, 277, 318, 349, 416
AjnI	CCWGG	1 cut(s)	333
AloI	GAACNNNNNNTCC	2 cut(s)	329, 361
AluBI	AGCT	2 cut(s)	37, 373
AluI	AGCT	2 cut(s)	37, 373
Alw26I	GTCTC	2 cut(s)	36, 225
AoxI	GGCC	1 cut(s)	449
ApeKI	GCWGC	1 cut(s)	8
ApoI	RAATTY	1 cut(s)	193
AspS9I	GGNCC	2 cut(s)	428, 449
AvaII	GGWCC	1 cut(s)	428
AxyI	CCTNAGG	1 cut(s)	48
BccI	CCATC	1 cut(s)	181
BciT130I	CCWGG	1 cut(s)	335
BcoDI	GTCTC	2 cut(s)	36, 225
BfaI	CTAG	2 cut(s)	72, 529
BfmI	CTRYAG	1 cut(s)	435
BisI	GCNGC	1 cut(s)	9
BlsI	GCNGC	1 cut(s)	10
BmcAI	AGTACT	1 cut(s)	127
Bme1390I	CCNGG	1 cut(s)	335
Bme18I	GGWCC	1 cut(s)	428
BmgT120I	GGNCC	2 cut(s)	428, 449
BmiI	GGNNCC	1 cut(s)	430
BmrFI	CCNGG	1 cut(s)	335
Bse1I	ACTGG	1 cut(s)	492
Bse21I	CCTNAGG	1 cut(s)	48
BseBI	CCWGG	1 cut(s)	335
BseMII	CTCAG	5 cut(s)	39, 47, 107, 120, 149
BseNI	ACTGG	1 cut(s)	492
BshFI	GGCC	1 cut(s)	451
BslFI	GGGAC	1 cut(s)	498
BsmAI	GTCTC	2 cut(s)	36, 225
BsmFI	GGGAC	1 cut(s)	498
BsmI	GAATGC	1 cut(s)	184
BsnI	GGCC	1 cut(s)	451
Bsp143I	GATC	2 cut(s)	241, 297
BspACI	CCGC	1 cut(s)	200
BspANI	GGCC	1 cut(s)	451
BspCNI	CTCAG	5 cut(s)	40, 46, 108, 121, 148
BspLI	GGNNCC	1 cut(s)	430
BspMAI	CTGCAG	1 cut(s)	439
BsrI	ACTGG	1 cut(s)	492
BssMI	GATC	2 cut(s)	241, 297
Bst2UI	CCWGG	1 cut(s)	335
Bst4CI	ACNGT	1 cut(s)	379
BstC8I	GCNNGC	1 cut(s)	525
BstDEI	CTNAG	6 cut(s)	33, 48, 116, 129, 135, 291
BstKTI	GATC	2 cut(s)	244, 300
BstMAI	GTCTC	2 cut(s)	36, 225
BstMBI	GATC	2 cut(s)	241, 297
BstMWI	GCNNNNNNNGC	3 cut(s)	34, 101, 155
BstNI	CCWGG	1 cut(s)	335
BstNSI	RCATGY	1 cut(s)	95
BstSCI	CCNGG	1 cut(s)	333
BstSFI	CTRYAG	1 cut(s)	435
BstXI	CCANNNNNNTGG	1 cut(s)	174
Bsu36I	CCTNAGG	1 cut(s)	48
BsuRI	GGCC	1 cut(s)	451
BtsIMutI	CAGTG	1 cut(s)	87
Cac8I	GCNNGC	1 cut(s)	525
Cfr13I	GGNCC	2 cut(s)	428, 449
Csp6I	GTAC	1 cut(s)	126
CviAII	CATG	4 cut(s)	92, 214, 311, 481
CviJI	RGCY	6 cut(s)	28, 37, 134, 321, 373, 451
CviKI_1	RGCY	6 cut(s)	28, 37, 134, 321, 373, 451
CviQI	GTAC	1 cut(s)	126
DdeI	CTNAG	6 cut(s)	33, 48, 116, 129, 135, 291
DpnI	GATC	2 cut(s)	243, 299
DpnII	GATC	2 cut(s)	241, 297
Eco47I	GGWCC	1 cut(s)	428
Eco57I	CTGAAG	2 cut(s)	63, 243
Eco81I	CCTNAGG	1 cut(s)	48
EcoRII	CCWGG	1 cut(s)	333
FaeI	CATG	4 cut(s)	95, 217, 314, 484
FalI	AAGNNNNNCTT	4 cut(s)	310, 342, 357, 389
FaqI	GGGAC	1 cut(s)	498
FatI	CATG	4 cut(s)	91, 213, 310, 480
FblI	GTMKAC	1 cut(s)	404
Fnu4HI	GCNGC	1 cut(s)	9
Fsp4HI	GCNGC	1 cut(s)	9
FspBI	CTAG	2 cut(s)	72, 529
GluI	GCNGC	1 cut(s)	9
HaeIII	GGCC	1 cut(s)	451
Hin1II	CATG	4 cut(s)	95, 217, 314, 484
HincII	GTYRAC	1 cut(s)	405
HindII	GTYRAC	1 cut(s)	405
HindIII	AAGCTT	1 cut(s)	371
HinfI	GANTC	6 cut(s)	56, 118, 218, 251, 263, 314
Hpy166II	GTNNAC	1 cut(s)	405
Hpy188I	TCNGA	4 cut(s)	138, 262, 268, 331
Hpy188III	TCNNGA	1 cut(s)	175
Hpy8I	GTNNAC	1 cut(s)	405
HpyCH4III	ACNGT	1 cut(s)	379
HpyCH4IV	ACGT	1 cut(s)	340
HpyCH4V	TGCA	3 cut(s)	158, 437, 464
HpyF10VI	GCNNNNNNNGC	3 cut(s)	34, 101, 155
HpyF3I	CTNAG	6 cut(s)	33, 48, 116, 129, 135, 291
HpySE526I	ACGT	1 cut(s)	340
Hsp92II	CATG	4 cut(s)	95, 217, 314, 484
Kzo9I	GATC	2 cut(s)	241, 297
LpnPI	CCDG	9 cut(s)	60, 86, 160, 320, 347, 447, 459, 469, 473
MaeI	CTAG	2 cut(s)	72, 529
MaeII	ACGT	1 cut(s)	340
MaeIII	GTNAC	1 cut(s)	161
MalI	GATC	2 cut(s)	243, 299
MboI	GATC	2 cut(s)	241, 297
MboII	GAAGA	1 cut(s)	318
MluCI	AATT	4 cut(s)	193, 209, 235, 397
MlyI	GAGTC	3 cut(s)	65, 127, 227
MnlI	CCTC	4 cut(s)	43, 124, 262, 298
MspR9I	CCNGG	1 cut(s)	335
Mva1269I	GAATGC	1 cut(s)	184
MvaI	CCWGG	1 cut(s)	335
MwoI	GCNNNNNNNGC	3 cut(s)	34, 101, 155
NdeII	GATC	2 cut(s)	241, 297
NlaIII	CATG	4 cut(s)	95, 217, 314, 484
NlaIV	GGNNCC	1 cut(s)	430
NmuCI	GTSAC	1 cut(s)	161
NspI	RCATGY	1 cut(s)	95
PctI	GAATGC	1 cut(s)	184
PfeI	GAWTC	3 cut(s)	251, 263, 314
PkrI	GCNGC	1 cut(s)	10
PleI	GAGTC	3 cut(s)	64, 126, 226
PpsI	GAGTC	3 cut(s)	64, 126, 226
Psp6I	CCWGG	1 cut(s)	333
PspGI	CCWGG	1 cut(s)	333
PspN4I	GGNNCC	1 cut(s)	430
PspPI	GGNCC	2 cut(s)	428, 449
PstI	CTGCAG	1 cut(s)	439
RsaI	GTAC	1 cut(s)	127
RsaNI	GTAC	1 cut(s)	126
SalI	GTCGAC	1 cut(s)	403
SatI	GCNGC	1 cut(s)	9
Sau3AI	GATC	2 cut(s)	241, 297
Sau96I	GGNCC	2 cut(s)	428, 449
ScaI	AGTACT	1 cut(s)	127
SchI	GAGTC	3 cut(s)	65, 127, 227
ScrFI	CCNGG	1 cut(s)	335
SetI	ASST	6 cut(s)	21, 39, 273, 336, 343, 375
SfcI	CTRYAG	1 cut(s)	435
SinI	GGWCC	1 cut(s)	428
Sse9I	AATT	4 cut(s)	193, 209, 235, 397
SsiI	CCGC	1 cut(s)	200
SspMI	CTAG	2 cut(s)	72, 529
StyD4I	CCNGG	1 cut(s)	333
TaaI	ACNGT	1 cut(s)	379
TaiI	ACGT	1 cut(s)	343
TaqI	TCGA	3 cut(s)	121, 152, 404
TasI	AATT	4 cut(s)	193, 209, 235, 397
TatI	WGTACW	1 cut(s)	125
TfiI	GAWTC	3 cut(s)	251, 263, 314
TscAI	CASTG	1 cut(s)	87
TseFI	GTSAC	1 cut(s)	161
TseI	GCWGC	1 cut(s)	8
Tsp45I	GTSAC	1 cut(s)	161
TspDTI	ATGAA	3 cut(s)	202, 264, 469
TspGWI	ACGGA	1 cut(s)	49
TspRI	CASTG	1 cut(s)	87
VpaK11BI	GGWCC	1 cut(s)	428
XapI	RAATTY	1 cut(s)	193
XceI	RCATGY	1 cut(s)	95
XmiI	GTMKAC	1 cut(s)	404
XspI	CTAG	2 cut(s)	72, 529
ZrmI	AGTACT	1 cut(s)	127

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.