Prupe.4G098100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
4984495 .. 4986402
1908 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G098100.1

Sequence Viewer

Length: 264 bp
ATGATTCATGCAGTTGACAAATTCGGGAGCTTCTTAAGGCAATTTCCTCTTTTTCCAAATGCTTTTCTGGTTGGTGGTTGGTGCAGAAGACTTCTTTATTATTCAACTTGCAGATCAGGCCCGAGTCATTGGGTATTATTGTTGGAATTATTTTCTTGGTCTTGGGAATCTTATTCTAGTTTTTCAACTTCACTGCAGATTCAAATAGTTAAAACCTCCGCCGAGGACAAGAAAGAACATAAGCCACCTCTACAGCTGAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.13

Weight (kDa)

9.1

Isoelectric Point (pI)

47.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 219
AcsI RAATTY 1 cut(s) 20
AflII CTTAAG 1 cut(s) 34
AgsI TTSAA 3 cut(s) 105, 186, 203
AluBI AGCT 3 cut(s) 30, 256, 261
AluI AGCT 3 cut(s) 30, 256, 261
Ama87I CYCGRG 1 cut(s) 121
AoxI GGCC 1 cut(s) 118
ApoI RAATTY 1 cut(s) 20
AspS9I GGNCC 1 cut(s) 119
AvaI CYCGRG 1 cut(s) 121
BbsI GAAGAC 1 cut(s) 94
BfaI CTAG 1 cut(s) 177
BfmI CTRYAG 2 cut(s) 194, 251
BfrI CTTAAG 1 cut(s) 34
BlpI GCTNAGC 1 cut(s) 257
BmeT110I CYCGRG 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 119
BpiI GAAGAC 1 cut(s) 94
Bpu1102I GCTNAGC 1 cut(s) 257
BsaJI CCNNGG 1 cut(s) 222
BseDI CCNNGG 1 cut(s) 222
BseMII CTCAG 1 cut(s) 248
BsgI GTGCAG 1 cut(s) 103
BshFI GGCC 1 cut(s) 120
BsiHKCI CYCGRG 1 cut(s) 121
BsnI GGCC 1 cut(s) 120
BsoBI CYCGRG 1 cut(s) 121
Bsp143I GATC 1 cut(s) 113
Bsp1720I GCTNAGC 1 cut(s) 257
BspACI CCGC 1 cut(s) 219
BspANI GGCC 1 cut(s) 120
BspCNI CTCAG 1 cut(s) 249
BspMAI CTGCAG 1 cut(s) 198
BspTI CTTAAG 1 cut(s) 34
BssECI CCNNGG 1 cut(s) 222
BssMI GATC 1 cut(s) 113
BstAFI CTTAAG 1 cut(s) 34
BstDEI CTNAG 1 cut(s) 257
BstKTI GATC 1 cut(s) 116
BstMBI GATC 1 cut(s) 113
BstMWI GCNNNNNNNGC 1 cut(s) 117
BstSFI CTRYAG 2 cut(s) 194, 251
BstV2I GAAGAC 1 cut(s) 94
BsuRI GGCC 1 cut(s) 120
BtsI GCAGTG 1 cut(s) 191
BtsIMutI CAGTG 1 cut(s) 191
Cfr13I GGNCC 1 cut(s) 119
CviAII CATG 1 cut(s) 8
CviJI RGCY 5 cut(s) 30, 120, 244, 256, 261
CviKI_1 RGCY 5 cut(s) 30, 120, 244, 256, 261
DdeI CTNAG 1 cut(s) 257
DpnI GATC 1 cut(s) 115
DpnII GATC 1 cut(s) 113
EciI GGCGGA 1 cut(s) 208
Eco88I CYCGRG 1 cut(s) 121
FaeI CATG 1 cut(s) 11
FaiI YATR 2 cut(s) 9, 240
FatI CATG 1 cut(s) 7
FspBI CTAG 1 cut(s) 177
HaeIII GGCC 1 cut(s) 120
Hin1II CATG 1 cut(s) 11
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
HinfI GANTC 4 cut(s) 4, 124, 167, 199
Hpy166II GTNNAC 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 25
Hpy8I GTNNAC 1 cut(s) 16
HpyCH4V TGCA 4 cut(s) 11, 84, 111, 196
HpyF10VI GCNNNNNNNGC 1 cut(s) 117
HpyF3I CTNAG 1 cut(s) 257
Hsp92II CATG 1 cut(s) 11
Kzo9I GATC 1 cut(s) 113
LmnI GCTCC 1 cut(s) 27
LpnPI CCDG 2 cut(s) 53, 102
MaeI CTAG 1 cut(s) 177
MalI GATC 1 cut(s) 115
MboI GATC 1 cut(s) 113
MboII GAAGA 1 cut(s) 99
MluCI AATT 3 cut(s) 20, 41, 146
MlyI GAGTC 1 cut(s) 133
MmeI TCCRAC 1 cut(s) 123
MnlI CCTC 4 cut(s) 57, 217, 226, 258
MseI TTAA 2 cut(s) 35, 210
MspA1I CMGCKG 1 cut(s) 256
MspCI CTTAAG 1 cut(s) 34
MwoI GCNNNNNNNGC 1 cut(s) 117
NdeII GATC 1 cut(s) 113
NlaIII CATG 1 cut(s) 11
NmeAIII GCCGAG 1 cut(s) 247
PfeI GAWTC 3 cut(s) 4, 167, 199
PleI GAGTC 1 cut(s) 132
PpsI GAGTC 1 cut(s) 132
PspPI GGNCC 1 cut(s) 119
PstI CTGCAG 1 cut(s) 198
PvuII CAGCTG 1 cut(s) 256
SaqAI TTAA 2 cut(s) 35, 210
Sau3AI GATC 1 cut(s) 113
Sau96I GGNCC 1 cut(s) 119
SchI GAGTC 1 cut(s) 133
SetI ASST 5 cut(s) 32, 218, 250, 258, 263
SfcI CTRYAG 2 cut(s) 194, 251
SmlI CTYRAG 1 cut(s) 34
SmoI CTYRAG 1 cut(s) 34
Sse9I AATT 3 cut(s) 20, 41, 146
SsiI CCGC 1 cut(s) 219
SspMI CTAG 1 cut(s) 177
TasI AATT 3 cut(s) 20, 41, 146
TfiI GAWTC 3 cut(s) 4, 167, 199
Tru1I TTAA 2 cut(s) 35, 210
Tru9I TTAA 2 cut(s) 35, 210
TscAI CASTG 1 cut(s) 198
TspRI CASTG 1 cut(s) 198
Vha464I CTTAAG 1 cut(s) 34
XapI RAATTY 1 cut(s) 20
XspI CTAG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.