Rmu_ssc0000309.1_g000060

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000309.1
Physical Location & Seq
Forward (+)
272460 .. 273924
1465 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000309.1_g000060.1.cds

Sequence Viewer

Length: 492 bp
atggtagcaatcaatcctctagttttctttgggcagctttttgaagttcaacttgacaactctgaagtccttctacgattctcatctgctcttgttcaaggtgctacaaacgttttctggattgacattcagtcaaatacaaggcggtttgaatccctctttctttatcttcttgaggatgttgctttggaacccacccggttaaataaaattcctgtacaggtccagcgagatctgtatcttttactttcaaggtttatattcttttataactcagttgacaaacttgagagcttcttaaggcactttcccgtattcccgaatgcttttctggttggtggtcctgcagacttctttgttattgaacttgcagatcagcttcaaaaattgaaggtggaaccggtattgctccattacttttcacacattaaagttctccagggtaatatttttaaccattttacatcgtttatgattcaaagattcatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

163

Amino Acids

19.08

Weight (kDa)

6.05

Isoelectric Point (pI)

43.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 270
AciI CCGC 1 cut(s) 145
AclI AACGTT 1 cut(s) 111
AcsI RAATTY 1 cut(s) 210
AcuI CTGAAG 1 cut(s) 84
AfaI GTAC 1 cut(s) 219
AflII CTTAAG 1 cut(s) 298
AgeI ACCGGT 1 cut(s) 400
AgsI TTSAA 9 cut(s) 44, 50, 98, 152, 252, 365, 383, 391, 479
AhdI GACNNNNNGTC 1 cut(s) 130
AjnI CCWGG 1 cut(s) 438
AluBI AGCT 3 cut(s) 37, 294, 379
AluI AGCT 3 cut(s) 37, 294, 379
ApeKI GCWGC 1 cut(s) 34
ApoI RAATTY 1 cut(s) 210
AsiGI ACCGGT 1 cut(s) 400
Asp700I GAANNNNTTC 1 cut(s) 69
AspS9I GGNCC 2 cut(s) 223, 341
AsuC2I CCSGG 1 cut(s) 199
AvaII GGWCC 2 cut(s) 223, 341
BarI GAAGNNNNNNTAC 2 cut(s) 57, 89
BbvI GCAGC 1 cut(s) 46
BciT130I CCWGG 1 cut(s) 440
BcnI CCSGG 1 cut(s) 199
BfaI CTAG 1 cut(s) 20
BfmI CTRYAG 1 cut(s) 345
BfrI CTTAAG 1 cut(s) 298
BglII AGATCT 1 cut(s) 232
BisI GCNGC 1 cut(s) 35
BlsI GCNGC 1 cut(s) 36
Bme1390I CCNGG 2 cut(s) 199, 440
Bme18I GGWCC 2 cut(s) 223, 341
BmeRI GACNNNNNGTC 1 cut(s) 130
BmgT120I GGNCC 2 cut(s) 223, 341
BmiI GGNNCC 2 cut(s) 192, 399
BmrFI CCNGG 2 cut(s) 199, 440
BpmI CTGGAG 1 cut(s) 422
BpuEI CTTGAG 2 cut(s) 194, 308
BpuMI CCSGG 1 cut(s) 199
BsaBI GATNNNNATC 2 cut(s) 82, 237
BsaJI CCNNGG 1 cut(s) 439
BsaWI WCCGGW 1 cut(s) 400
Bse118I RCCGGY 1 cut(s) 400
Bse8I GATNNNNATC 2 cut(s) 82, 237
BseBI CCWGG 1 cut(s) 440
BseDI CCNNGG 1 cut(s) 439
BseGI GGATG 1 cut(s) 184
BseJI GATNNNNATC 2 cut(s) 82, 237
BseMII CTCAG 1 cut(s) 288
BseXI GCAGC 1 cut(s) 46
BshTI ACCGGT 1 cut(s) 400
BsiSI CCGG 2 cut(s) 199, 401
BsmI GAATGC 1 cut(s) 328
Bsp1407I TGTACA 1 cut(s) 217
Bsp143I GATC 2 cut(s) 232, 373
BspACI CCGC 1 cut(s) 145
BspCNI CTCAG 1 cut(s) 287
BspLI GGNNCC 2 cut(s) 192, 399
BspMAI CTGCAG 1 cut(s) 349
BspTI CTTAAG 1 cut(s) 298
BsrFI RCCGGY 1 cut(s) 400
BsrGI TGTACA 1 cut(s) 217
BssAI RCCGGY 1 cut(s) 400
BssECI CCNNGG 1 cut(s) 439
BssMI GATC 2 cut(s) 232, 373
Bst2UI CCWGG 1 cut(s) 440
BstAFI CTTAAG 1 cut(s) 298
BstAUI TGTACA 1 cut(s) 217
BstDEI CTNAG 1 cut(s) 274
BstF5I GGATG 1 cut(s) 184
BstKTI GATC 2 cut(s) 235, 376
BstMBI GATC 2 cut(s) 232, 373
BstNI CCWGG 1 cut(s) 440
BstSCI CCNGG 2 cut(s) 197, 438
BstSFI CTRYAG 1 cut(s) 345
BstV1I GCAGC 1 cut(s) 46
BstX2I RGATCY 1 cut(s) 232
BstYI RGATCY 1 cut(s) 232
BtsCI GGATG 1 cut(s) 184
Cfr10I RCCGGY 1 cut(s) 400
Cfr13I GGNCC 2 cut(s) 223, 341
Csp6I GTAC 1 cut(s) 218
CspAI ACCGGT 1 cut(s) 400
CviJI RGCY 3 cut(s) 37, 294, 379
CviKI_1 RGCY 3 cut(s) 37, 294, 379
CviQI GTAC 1 cut(s) 218
DdeI CTNAG 1 cut(s) 274
DpnI GATC 2 cut(s) 234, 375
DpnII GATC 2 cut(s) 232, 373
DriI GACNNNNNGTC 1 cut(s) 130
Eam1105I GACNNNNNGTC 1 cut(s) 130
Eco47I GGWCC 2 cut(s) 223, 341
Eco57I CTGAAG 1 cut(s) 84
EcoRII CCWGG 1 cut(s) 438
FaiI YATR 5 cut(s) 260, 270, 473, 488, 490
FalI AAGNNNNNCTT 2 cut(s) 36, 68
FauNDI CATATG 1 cut(s) 488
Fnu4HI GCNGC 1 cut(s) 35
FokI GGATG 1 cut(s) 191
Fsp4HI GCNGC 1 cut(s) 35
FspBI CTAG 1 cut(s) 20
GluI GCNGC 1 cut(s) 35
GsuI CTGGAG 1 cut(s) 422
HapII CCGG 2 cut(s) 199, 401
HincII GTYRAC 1 cut(s) 280
HindII GTYRAC 1 cut(s) 280
HinfI GANTC 4 cut(s) 78, 152, 475, 483
HpaII CCGG 2 cut(s) 199, 401
Hpy166II GTNNAC 1 cut(s) 280
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 3 cut(s) 118, 173, 319
Hpy8I GTNNAC 1 cut(s) 280
HpyAV CCTTC 2 cut(s) 80, 385
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 2 cut(s) 347, 371
HpyF3I CTNAG 1 cut(s) 274
HpySE526I ACGT 1 cut(s) 111
Kzo9I GATC 2 cut(s) 232, 373
LmnI GCTCC 1 cut(s) 414
Lsp1109I GCAGC 1 cut(s) 46
MaeI CTAG 1 cut(s) 20
MaeII ACGT 1 cut(s) 111
MalI GATC 2 cut(s) 234, 375
MboI GATC 2 cut(s) 232, 373
MboII GAAGA 1 cut(s) 161
MflI RGATCY 1 cut(s) 232
MluCI AATT 2 cut(s) 210, 386
MnlI CCTC 3 cut(s) 27, 167, 169
MroXI GAANNNNTTC 1 cut(s) 69
MseI TTAA 4 cut(s) 203, 299, 429, 453
MspCI CTTAAG 1 cut(s) 298
MspI CCGG 2 cut(s) 199, 401
MspR9I CCNGG 2 cut(s) 199, 440
Mva1269I GAATGC 1 cut(s) 328
MvaI CCWGG 1 cut(s) 440
NciI CCSGG 1 cut(s) 199
NdeI CATATG 1 cut(s) 488
NdeII GATC 2 cut(s) 232, 373
NlaIV GGNNCC 2 cut(s) 192, 399
PctI GAATGC 1 cut(s) 328
PdmI GAANNNNTTC 1 cut(s) 69
PfeI GAWTC 4 cut(s) 78, 152, 475, 483
PinAI ACCGGT 1 cut(s) 400
PkrI GCNGC 1 cut(s) 36
PsiI TTATAA 1 cut(s) 270
Psp1406I AACGTT 1 cut(s) 111
Psp6I CCWGG 1 cut(s) 438
PspGI CCWGG 1 cut(s) 438
PspN4I GGNNCC 2 cut(s) 192, 399
PspPI GGNCC 2 cut(s) 223, 341
PstI CTGCAG 1 cut(s) 349
PsuI RGATCY 1 cut(s) 232
RsaI GTAC 1 cut(s) 219
RsaNI GTAC 1 cut(s) 218
SaqAI TTAA 4 cut(s) 203, 299, 429, 453
SatI GCNGC 1 cut(s) 35
Sau3AI GATC 2 cut(s) 232, 373
Sau96I GGNCC 2 cut(s) 223, 341
ScrFI CCNGG 2 cut(s) 199, 440
SetI ASST 8 cut(s) 39, 103, 114, 225, 257, 296, 381, 396
SfcI CTRYAG 1 cut(s) 345
SinI GGWCC 2 cut(s) 223, 341
SmlI CTYRAG 3 cut(s) 173, 287, 298
SmoI CTYRAG 3 cut(s) 173, 287, 298
Sse9I AATT 2 cut(s) 210, 386
SsiI CCGC 1 cut(s) 145
SspI AATATT 1 cut(s) 448
SspMI CTAG 1 cut(s) 20
StyD4I CCNGG 2 cut(s) 197, 438
TaiI ACGT 1 cut(s) 114
TasI AATT 2 cut(s) 210, 386
TatI WGTACW 1 cut(s) 217
TfiI GAWTC 4 cut(s) 78, 152, 475, 483
Tru1I TTAA 4 cut(s) 203, 299, 429, 453
Tru9I TTAA 4 cut(s) 203, 299, 429, 453
TseI GCWGC 1 cut(s) 34
TspDTI ATGAA 1 cut(s) 475
Vha464I CTTAAG 1 cut(s) 298
VpaK11BI GGWCC 2 cut(s) 223, 341
XapI RAATTY 1 cut(s) 210
XmnI GAANNNNTTC 1 cut(s) 69
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.