Prupe.6G304300_v2.0.a1

Encoded by

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Reverse (-)
27536793 .. 27537059
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G304300.1

Sequence Viewer

Length: 267 bp
ATGGGAGGCAACAACAGGCAGAAAAAATCCTCCTTCTCATTCTTCAGCTTGTTCAAATCGAGGAGGCCTCGCAGAGGAGATGACATGGGGGAGGATTTGAATATGAGTGCAAGAAAGGTGTGGCCTAGTGAGGAGGACAGAGGCGGGTGGATAGCTGAGCCCGGCATCGACAACAAAGCTACTGCTTTCATTGACAGAATCCACAAGAGCATTGTCTCAGAATCTGATTGCCAAACCTTAACTGTAAACCCTGCTGGAAAGTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

9.85

Weight (kDa)

9.36

Isoelectric Point (pI)

55.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 144
AcuI CTGAAG 1 cut(s) 28
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 2 cut(s) 55, 100
AluBI AGCT 3 cut(s) 48, 155, 179
AluI AGCT 3 cut(s) 48, 155, 179
Alw26I GTCTC 1 cut(s) 220
AlwNI CAGNNNCTG 1 cut(s) 224
AoxI GGCC 2 cut(s) 65, 122
AsuC2I CCSGG 1 cut(s) 162
BanII GRGCYC 1 cut(s) 162
BcnI CCSGG 1 cut(s) 162
BcoDI GTCTC 1 cut(s) 220
BfaI CTAG 1 cut(s) 126
BlpI GCTNAGC 1 cut(s) 156
Bme1390I CCNGG 1 cut(s) 162
BmrFI CCNGG 1 cut(s) 162
BmsI GCATC 1 cut(s) 174
BplI GAGNNNNNCTC 2 cut(s) 52, 84
Bpu1102I GCTNAGC 1 cut(s) 156
BpuMI CCSGG 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 74
BseMII CTCAG 2 cut(s) 147, 231
BseRI GAGGAG 3 cut(s) 76, 90, 146
BshFI GGCC 2 cut(s) 67, 124
BsiSI CCGG 1 cut(s) 162
BslI CCNNNNNNNGG 1 cut(s) 74
BsmAI GTCTC 1 cut(s) 220
BsnI GGCC 2 cut(s) 67, 124
Bsp1286I GDGCHC 1 cut(s) 162
Bsp1720I GCTNAGC 1 cut(s) 156
BspACI CCGC 1 cut(s) 144
BspANI GGCC 2 cut(s) 67, 124
BspCNI CTCAG 2 cut(s) 148, 230
Bst4CI ACNGT 1 cut(s) 244
BstDEI CTNAG 2 cut(s) 156, 217
BstENI CCTNNNNNAGG 1 cut(s) 72
BstMAI GTCTC 1 cut(s) 220
BstSCI CCNGG 1 cut(s) 160
BsuRI GGCC 2 cut(s) 67, 124
CaiI CAGNNNCTG 1 cut(s) 224
CviAII CATG 1 cut(s) 85
CviJI RGCY 6 cut(s) 48, 67, 124, 155, 160, 179
CviKI_1 RGCY 6 cut(s) 48, 67, 124, 155, 160, 179
DdeI CTNAG 2 cut(s) 156, 217
Eco147I AGGCCT 1 cut(s) 67
Eco24I GRGCYC 1 cut(s) 162
Eco57I CTGAAG 1 cut(s) 28
EcoNI CCTNNNNNAGG 1 cut(s) 72
EcoT38I GRGCYC 1 cut(s) 162
FaeI CATG 1 cut(s) 88
FaiI YATR 2 cut(s) 86, 104
FatI CATG 1 cut(s) 84
FauI CCCGC 1 cut(s) 137
FriOI GRGCYC 1 cut(s) 162
FspBI CTAG 1 cut(s) 126
HaeIII GGCC 2 cut(s) 67, 124
HapII CCGG 1 cut(s) 162
Hin1II CATG 1 cut(s) 88
HinfI GANTC 2 cut(s) 198, 221
HpaII CCGG 1 cut(s) 162
Hpy166II GTNNAC 1 cut(s) 247
Hpy188I TCNGA 2 cut(s) 220, 226
Hpy8I GTNNAC 1 cut(s) 247
HpyAV CCTTC 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 244
HpyCH4V TGCA 1 cut(s) 110
HpyF3I CTNAG 2 cut(s) 156, 217
Hsp92II CATG 1 cut(s) 88
LpnPI CCDG 2 cut(s) 175, 240
LweI GCATC 1 cut(s) 174
MaeI CTAG 1 cut(s) 126
MboII GAAGA 1 cut(s) 34
MhlI GDGCHC 1 cut(s) 162
MnlI CCTC 9 cut(s) 40, 54, 57, 68, 78, 85, 124, 127, 134
MseI TTAA 1 cut(s) 239
MspI CCGG 1 cut(s) 162
MspR9I CCNGG 1 cut(s) 162
NciI CCSGG 1 cut(s) 162
NlaIII CATG 1 cut(s) 88
PceI AGGCCT 1 cut(s) 67
PfeI GAWTC 2 cut(s) 198, 221
PstNI CAGNNNCTG 1 cut(s) 224
SaqAI TTAA 1 cut(s) 239
ScrFI CCNGG 1 cut(s) 162
SduI GDGCHC 1 cut(s) 162
SetI ASST 5 cut(s) 50, 120, 157, 181, 239
SfaNI GCATC 1 cut(s) 174
SseBI AGGCCT 1 cut(s) 67
SsiI CCGC 1 cut(s) 144
SspMI CTAG 1 cut(s) 126
StuI AGGCCT 1 cut(s) 67
StyD4I CCNGG 1 cut(s) 160
TaaI ACNGT 1 cut(s) 244
TaqI TCGA 2 cut(s) 59, 168
TfiI GAWTC 2 cut(s) 198, 221
Tru1I TTAA 1 cut(s) 239
Tru9I TTAA 1 cut(s) 239
TspDTI ATGAA 1 cut(s) 178
XagI CCTNNNNNAGG 1 cut(s) 72
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.