Rmu_sc0000724.1_g000012

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000724.1
Physical Location & Seq
Forward (+)
62194 .. 62460
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000724.1_g000012.1.cds

Sequence Viewer

Length: 267 bp
atgggaggaaacaacagacacaagaaatcttctttctcattcttcagcttcttcaagtctcggaggcctcgccgaggagaagagatagaggattcatatttgagtacaacaagggtgtggcctagtgtggaggatagaggtcgatgggtagctgagcctggaattgacaacaaagctgctgatttcattggcagaatccacaagaacatggtctcggaatcggattgcaaaaccttaactgtaaacccagcagcaggaaaggactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.01

Weight (kDa)

9.57

Isoelectric Point (pI)

65.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 28
AfaI GTAC 1 cut(s) 106
AfiI CCNNNNNNNGG 2 cut(s) 74, 254
AgsI TTSAA 1 cut(s) 55
AjnI CCWGG 1 cut(s) 157
AluBI AGCT 3 cut(s) 48, 152, 176
AluI AGCT 3 cut(s) 48, 152, 176
Alw26I GTCTC 2 cut(s) 63, 217
AoxI GGCC 2 cut(s) 65, 119
ApeKI GCWGC 2 cut(s) 176, 251
BbvI GCAGC 2 cut(s) 163, 263
BccI CCATC 1 cut(s) 138
BciT130I CCWGG 1 cut(s) 159
BcoDI GTCTC 2 cut(s) 63, 217
BfaI CTAG 2 cut(s) 123, 265
BisI GCNGC 2 cut(s) 177, 252
BlpI GCTNAGC 1 cut(s) 153
BlsI GCNGC 2 cut(s) 178, 253
Bme1390I CCNGG 1 cut(s) 159
BmrFI CCNGG 1 cut(s) 159
Bpu1102I GCTNAGC 1 cut(s) 153
BsaI GGTCTC 1 cut(s) 217
BsaJI CCNNGG 1 cut(s) 73
Bsc4I CCNNNNNNNGG 2 cut(s) 74, 254
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 1 cut(s) 73
BseLI CCNNNNNNNGG 2 cut(s) 74, 254
BseMII CTCAG 1 cut(s) 144
BseRI GAGGAG 1 cut(s) 90
BseXI GCAGC 2 cut(s) 163, 263
BseYI CCCAGC 1 cut(s) 247
BshFI GGCC 2 cut(s) 67, 121
BslI CCNNNNNNNGG 2 cut(s) 74, 254
BsmAI GTCTC 2 cut(s) 63, 217
BsnI GGCC 2 cut(s) 67, 121
Bso31I GGTCTC 1 cut(s) 217
Bsp1720I GCTNAGC 1 cut(s) 153
BspANI GGCC 2 cut(s) 67, 121
BspCNI CTCAG 1 cut(s) 145
BspTNI GGTCTC 1 cut(s) 217
BssECI CCNNGG 1 cut(s) 73
Bst2UI CCWGG 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 241
Bst6I CTCTTC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 153
BstENI CCTNNNNNAGG 1 cut(s) 72
BstMAI GTCTC 2 cut(s) 63, 217
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstV1I GCAGC 2 cut(s) 163, 263
BsuRI GGCC 2 cut(s) 67, 121
Csp6I GTAC 1 cut(s) 105
CviAII CATG 1 cut(s) 208
CviJI RGCY 6 cut(s) 48, 67, 121, 152, 157, 176
CviKI_1 RGCY 6 cut(s) 48, 67, 121, 152, 157, 176
CviQI GTAC 1 cut(s) 105
DdeI CTNAG 1 cut(s) 153
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
Eco147I AGGCCT 1 cut(s) 67
Eco31I GGTCTC 1 cut(s) 217
Eco57I CTGAAG 1 cut(s) 28
EcoNI CCTNNNNNAGG 1 cut(s) 72
EcoRII CCWGG 1 cut(s) 157
FaeI CATG 1 cut(s) 211
FaiI YATR 2 cut(s) 97, 209
FatI CATG 1 cut(s) 207
Fnu4HI GCNGC 2 cut(s) 177, 252
Fsp4HI GCNGC 2 cut(s) 177, 252
FspBI CTAG 2 cut(s) 123, 265
GluI GCNGC 2 cut(s) 177, 252
GsaI CCCAGC 1 cut(s) 251
HaeIII GGCC 2 cut(s) 67, 121
Hin1II CATG 1 cut(s) 211
HinfI GANTC 3 cut(s) 92, 195, 218
Hpy166II GTNNAC 1 cut(s) 244
Hpy188I TCNGA 3 cut(s) 63, 217, 223
Hpy8I GTNNAC 1 cut(s) 244
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4V TGCA 1 cut(s) 228
HpyF3I CTNAG 1 cut(s) 153
Hsp92II CATG 1 cut(s) 211
LpnPI CCDG 4 cut(s) 144, 171, 240, 261
Lsp1109I GCAGC 2 cut(s) 163, 263
MaeI CTAG 2 cut(s) 123, 265
MboII GAAGA 4 cut(s) 21, 34, 43, 92
MluCI AATT 1 cut(s) 162
MnlI CCTC 6 cut(s) 57, 68, 78, 82, 124, 131
MseI TTAA 1 cut(s) 236
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
NlaIII CATG 1 cut(s) 211
NmeAIII GCCGAG 1 cut(s) 98
PceI AGGCCT 1 cut(s) 67
PfeI GAWTC 3 cut(s) 92, 195, 218
PkrI GCNGC 2 cut(s) 178, 253
Psp6I CCWGG 1 cut(s) 157
PspFI CCCAGC 1 cut(s) 247
PspGI CCWGG 1 cut(s) 157
RsaI GTAC 1 cut(s) 106
RsaNI GTAC 1 cut(s) 105
SaqAI TTAA 1 cut(s) 236
SatI GCNGC 2 cut(s) 177, 252
ScrFI CCNGG 1 cut(s) 159
SetI ASST 5 cut(s) 50, 142, 154, 178, 236
Sse9I AATT 1 cut(s) 162
SseBI AGGCCT 1 cut(s) 67
SspMI CTAG 2 cut(s) 123, 265
StuI AGGCCT 1 cut(s) 67
StyD4I CCNGG 1 cut(s) 157
TaaI ACNGT 1 cut(s) 241
TaqI TCGA 1 cut(s) 142
TasI AATT 1 cut(s) 162
TatI WGTACW 1 cut(s) 104
TfiI GAWTC 3 cut(s) 92, 195, 218
Tru1I TTAA 1 cut(s) 236
Tru9I TTAA 1 cut(s) 236
TseI GCWGC 2 cut(s) 176, 251
TspDTI ATGAA 2 cut(s) 84, 175
XagI CCTNNNNNAGG 1 cut(s) 72
XspI CTAG 2 cut(s) 123, 265
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.