Rh3BG091200

Encoded by

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
7112831 .. 7113534
704 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG091200.1

Sequence Viewer

Length: 270 bp
ATGGGAGGAAACAACAGACAGAAGAAATCTTCTCTCTCATTCTTCAGCTTCTTCAAGTCTCGGAGGCCTCGCCGAGGAGAAGAGATAGAGGATTCGTATTTGAGTGCAAGAAGGGTGTGGCCCAGTGTGGAGGATAGAGGCGGTCGATGGGTAGCTGAGCCTGGCATTGACAACAAAGCTGCTGATTTCATTGACAGAATCCACAAGAACATGGTCTCTGAATCGGATTGCAAAACCTTAACTGTAAACCCAGCAGCAGGAAAGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.11

Weight (kDa)

9.57

Isoelectric Point (pI)

68.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 141
AcuI CTGAAG 1 cut(s) 28
AfiI CCNNNNNNNGG 2 cut(s) 74, 257
AgsI TTSAA 1 cut(s) 55
AjnI CCWGG 1 cut(s) 160
AluBI AGCT 3 cut(s) 48, 155, 179
AluI AGCT 3 cut(s) 48, 155, 179
Alw26I GTCTC 2 cut(s) 63, 220
AoxI GGCC 2 cut(s) 65, 119
ApeKI GCWGC 2 cut(s) 179, 254
AspS9I GGNCC 1 cut(s) 120
BbvI GCAGC 2 cut(s) 166, 266
BccI CCATC 1 cut(s) 141
BciT130I CCWGG 1 cut(s) 162
BcoDI GTCTC 2 cut(s) 63, 220
BfaI CTAG 1 cut(s) 268
BisI GCNGC 2 cut(s) 180, 255
BlpI GCTNAGC 1 cut(s) 156
BlsI GCNGC 2 cut(s) 181, 256
Bme1390I CCNGG 1 cut(s) 162
BmgT120I GGNCC 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 162
BmrI ACTGGG 1 cut(s) 117
BmuI ACTGGG 1 cut(s) 117
Bpu1102I GCTNAGC 1 cut(s) 156
BsaI GGTCTC 1 cut(s) 220
BsaJI CCNNGG 1 cut(s) 73
Bsc4I CCNNNNNNNGG 2 cut(s) 74, 257
Bse1I ACTGG 1 cut(s) 123
BseBI CCWGG 1 cut(s) 162
BseDI CCNNGG 1 cut(s) 73
BseLI CCNNNNNNNGG 2 cut(s) 74, 257
BseMII CTCAG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 123
BseRI GAGGAG 1 cut(s) 90
BseXI GCAGC 2 cut(s) 166, 266
BseYI CCCAGC 1 cut(s) 250
Bsh1285I CGRYCG 1 cut(s) 145
BshFI GGCC 2 cut(s) 67, 121
BsiEI CGRYCG 1 cut(s) 145
BslI CCNNNNNNNGG 2 cut(s) 74, 257
BsmAI GTCTC 2 cut(s) 63, 220
BsnI GGCC 2 cut(s) 67, 121
Bso31I GGTCTC 1 cut(s) 220
Bsp1720I GCTNAGC 1 cut(s) 156
BspACI CCGC 1 cut(s) 141
BspANI GGCC 2 cut(s) 67, 121
BspCNI CTCAG 1 cut(s) 148
BspTNI GGTCTC 1 cut(s) 220
BsrI ACTGG 1 cut(s) 123
BssECI CCNNGG 1 cut(s) 73
Bst2UI CCWGG 1 cut(s) 162
Bst4CI ACNGT 1 cut(s) 244
Bst6I CTCTTC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 156
BstENI CCTNNNNNAGG 1 cut(s) 72
BstMAI GTCTC 2 cut(s) 63, 220
BstMCI CGRYCG 1 cut(s) 145
BstNI CCWGG 1 cut(s) 162
BstSCI CCNGG 1 cut(s) 160
BstV1I GCAGC 2 cut(s) 166, 266
BsuRI GGCC 2 cut(s) 67, 121
BtsIMutI CAGTG 1 cut(s) 130
Cfr13I GGNCC 1 cut(s) 120
CviAII CATG 1 cut(s) 211
CviJI RGCY 6 cut(s) 48, 67, 121, 155, 160, 179
CviKI_1 RGCY 6 cut(s) 48, 67, 121, 155, 160, 179
DdeI CTNAG 1 cut(s) 156
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
Eco147I AGGCCT 1 cut(s) 67
Eco31I GGTCTC 1 cut(s) 220
Eco57I CTGAAG 1 cut(s) 28
EcoNI CCTNNNNNAGG 1 cut(s) 72
EcoRII CCWGG 1 cut(s) 160
FaeI CATG 1 cut(s) 214
FaiI YATR 1 cut(s) 212
FatI CATG 1 cut(s) 210
Fnu4HI GCNGC 2 cut(s) 180, 255
Fsp4HI GCNGC 2 cut(s) 180, 255
FspBI CTAG 1 cut(s) 268
GluI GCNGC 2 cut(s) 180, 255
GsaI CCCAGC 1 cut(s) 254
HaeIII GGCC 2 cut(s) 67, 121
Hin1II CATG 1 cut(s) 214
HinfI GANTC 3 cut(s) 92, 198, 221
Hpy166II GTNNAC 1 cut(s) 247
Hpy188I TCNGA 3 cut(s) 63, 220, 226
Hpy8I GTNNAC 1 cut(s) 247
HpyAV CCTTC 1 cut(s) 105
HpyCH4III ACNGT 1 cut(s) 244
HpyCH4V TGCA 2 cut(s) 107, 231
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 1 cut(s) 214
LpnPI CCDG 5 cut(s) 136, 147, 174, 243, 264
Lsp1109I GCAGC 2 cut(s) 166, 266
MaeI CTAG 1 cut(s) 268
MboII GAAGA 5 cut(s) 21, 34, 34, 43, 92
MnlI CCTC 6 cut(s) 57, 68, 78, 82, 124, 131
MseI TTAA 1 cut(s) 239
MspR9I CCNGG 1 cut(s) 162
MvaI CCWGG 1 cut(s) 162
NlaIII CATG 1 cut(s) 214
NmeAIII GCCGAG 1 cut(s) 98
PceI AGGCCT 1 cut(s) 67
PfeI GAWTC 3 cut(s) 92, 198, 221
PkrI GCNGC 2 cut(s) 181, 256
Psp6I CCWGG 1 cut(s) 160
PspFI CCCAGC 1 cut(s) 250
PspGI CCWGG 1 cut(s) 160
PspPI GGNCC 1 cut(s) 120
SaqAI TTAA 1 cut(s) 239
SatI GCNGC 2 cut(s) 180, 255
Sau96I GGNCC 1 cut(s) 120
ScrFI CCNGG 1 cut(s) 162
SetI ASST 4 cut(s) 50, 157, 181, 239
SseBI AGGCCT 1 cut(s) 67
SsiI CCGC 1 cut(s) 141
SspMI CTAG 1 cut(s) 268
StuI AGGCCT 1 cut(s) 67
StyD4I CCNGG 1 cut(s) 160
TaaI ACNGT 1 cut(s) 244
TaqI TCGA 1 cut(s) 145
TfiI GAWTC 3 cut(s) 92, 198, 221
Tru1I TTAA 1 cut(s) 239
Tru9I TTAA 1 cut(s) 239
TscAI CASTG 1 cut(s) 130
TseI GCWGC 2 cut(s) 179, 254
TspDTI ATGAA 1 cut(s) 178
TspRI CASTG 1 cut(s) 130
XagI CCTNNNNNAGG 1 cut(s) 72
XspI CTAG 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.