Prupe.8G114900_v2.0.a1

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
14242238 .. 14244417
2180 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G114900.1

Sequence Viewer

Length: 357 bp
ATGAACCCCATGGATTCACAGACCCAGAACACCTCGTTGCAGAGGCTTCAAAATGTGGAGAAAAGAATCGTTAAGGTTTTGGAGCTAGCTGGAGGTGTCATGGACGAGCTTGCAAACCCTAGTGGTCCCAGAAAGGAGTTTATCAACAACCATTGCCGTGAGTTCATGCAATTGATCAAGGATATTCAAGTGGCACTGCGGGATGAAATTAAAAGTGCATGTGATTACCGTCCGTTTGAGAAGTGTGATTACAGTTCAAGAGTAGCTAATGAAATCTGTTGCAAGAAACTGGAATATGTCATGTCACAGTTGGATGCAATGAAAGAAACAATGGACGAATATCGTAATGCAGTTTGA

Protein Analysis

119

Amino Acids

13.7

Weight (kDa)

5.47

Isoelectric Point (pI)

37.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 199
AgsI TTSAA 3 cut(s) 50, 188, 258
AluBI AGCT 4 cut(s) 85, 89, 109, 266
AluI AGCT 4 cut(s) 85, 89, 109, 266
AspS9I GGNCC 1 cut(s) 125
AsuNHI GCTAGC 1 cut(s) 85
AvaII GGWCC 1 cut(s) 125
BarI GAAGNNNNNNTAC 2 cut(s) 233, 265
BceAI ACGGC 1 cut(s) 141
BclI TGATCA 1 cut(s) 174
BfaI CTAG 2 cut(s) 86, 120
Bme18I GGWCC 1 cut(s) 125
BmgT120I GGNCC 1 cut(s) 125
BmiI GGNNCC 1 cut(s) 127
BmsI GCATC 1 cut(s) 304
BmtI GCTAGC 1 cut(s) 89
BpmI CTGGAG 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 9
Bse1I ACTGG 1 cut(s) 294
Bse3DI GCAATG 2 cut(s) 151, 324
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 2 cut(s) 208, 319
BseMI GCAATG 2 cut(s) 151, 324
BseNI ACTGG 1 cut(s) 294
BslFI GGGAC 1 cut(s) 111
BsmFI GGGAC 1 cut(s) 111
Bsp143I GATC 1 cut(s) 174
Bsp19I CCATGG 1 cut(s) 9
BspACI CCGC 1 cut(s) 199
BspLI GGNNCC 1 cut(s) 127
BspOI GCTAGC 1 cut(s) 89
BsrDI GCAATG 2 cut(s) 151, 324
BsrI ACTGG 1 cut(s) 294
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 1 cut(s) 174
BssT1I CCWWGG 1 cut(s) 9
Bst4CI ACNGT 3 cut(s) 230, 254, 309
BstC8I GCNNGC 2 cut(s) 87, 111
BstDSI CCRYGG 1 cut(s) 9
BstF5I GGATG 2 cut(s) 208, 319
BstKTI GATC 1 cut(s) 177
BstMBI GATC 1 cut(s) 174
BstNSI RCATGY 1 cut(s) 222
BtgI CCRYGG 1 cut(s) 9
BtsCI GGATG 2 cut(s) 208, 319
BtsI GCAGTG 1 cut(s) 194
BtsIMutI CAGTG 1 cut(s) 194
Cac8I GCNNGC 2 cut(s) 87, 111
Cfr13I GGNCC 1 cut(s) 125
CviAII CATG 5 cut(s) 10, 100, 166, 219, 301
CviJI RGCY 5 cut(s) 46, 85, 89, 109, 266
CviKI_1 RGCY 5 cut(s) 46, 85, 89, 109, 266
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
Eco130I CCWWGG 1 cut(s) 9
Eco47I GGWCC 1 cut(s) 125
EcoT14I CCWWGG 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 9
FaeI CATG 5 cut(s) 13, 103, 169, 222, 304
FaiI YATR 6 cut(s) 11, 101, 167, 220, 297, 302
FaqI GGGAC 1 cut(s) 111
FatI CATG 5 cut(s) 9, 99, 165, 218, 300
FauI CCCGC 1 cut(s) 192
FbaI TGATCA 1 cut(s) 174
FokI GGATG 2 cut(s) 215, 326
FspBI CTAG 2 cut(s) 86, 120
GsuI CTGGAG 1 cut(s) 111
Hin1II CATG 5 cut(s) 13, 103, 169, 222, 304
HinfI GANTC 2 cut(s) 14, 66
Hpy188III TCNNGA 1 cut(s) 258
HpyCH4III ACNGT 3 cut(s) 230, 254, 309
HpyCH4V TGCA 7 cut(s) 40, 113, 169, 218, 282, 317, 350
Hsp92II CATG 5 cut(s) 13, 103, 169, 222, 304
Ksp22I TGATCA 1 cut(s) 174
Kzo9I GATC 1 cut(s) 174
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 4 cut(s) 38, 75, 142, 275
LweI GCATC 1 cut(s) 304
MaeI CTAG 2 cut(s) 86, 120
MaeIII GTNAC 1 cut(s) 303
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MfeI CAATTG 1 cut(s) 170
MluCI AATT 2 cut(s) 170, 207
MmeI TCCRAC 1 cut(s) 291
MnlI CCTC 3 cut(s) 36, 43, 86
MseI TTAA 2 cut(s) 72, 210
MslI CAYNNNNRTG 1 cut(s) 156
MunI CAATTG 1 cut(s) 170
NcoI CCATGG 1 cut(s) 9
NdeII GATC 1 cut(s) 174
NheI GCTAGC 1 cut(s) 85
NlaIII CATG 5 cut(s) 13, 103, 169, 222, 304
NlaIV GGNNCC 1 cut(s) 127
NmuCI GTSAC 1 cut(s) 303
NspI RCATGY 1 cut(s) 222
PfeI GAWTC 2 cut(s) 14, 66
PspN4I GGNNCC 1 cut(s) 127
PspPI GGNCC 1 cut(s) 125
RseI CAYNNNNRTG 1 cut(s) 156
SaqAI TTAA 2 cut(s) 72, 210
Sau3AI GATC 1 cut(s) 174
Sau96I GGNCC 1 cut(s) 125
SetI ASST 7 cut(s) 35, 78, 87, 91, 97, 111, 268
SfaNI GCATC 1 cut(s) 304
SinI GGWCC 1 cut(s) 125
SmiMI CAYNNNNRTG 1 cut(s) 156
Sse9I AATT 2 cut(s) 170, 207
SsiI CCGC 1 cut(s) 199
SspMI CTAG 2 cut(s) 86, 120
StyI CCWWGG 1 cut(s) 9
TaaI ACNGT 3 cut(s) 230, 254, 309
TasI AATT 2 cut(s) 170, 207
TfiI GAWTC 2 cut(s) 14, 66
Tru1I TTAA 2 cut(s) 72, 210
Tru9I TTAA 2 cut(s) 72, 210
TscAI CASTG 1 cut(s) 201
TseFI GTSAC 1 cut(s) 303
Tsp45I GTSAC 1 cut(s) 303
TspDTI ATGAA 5 cut(s) 17, 154, 219, 285, 335
TspGWI ACGGA 1 cut(s) 222
TspRI CASTG 1 cut(s) 201
VpaK11BI GGWCC 1 cut(s) 125
XceI RCATGY 1 cut(s) 222
XspI CTAG 2 cut(s) 86, 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.