RchiOBHm_Chr7g0240711

mediator of RNA polymerase II transcription subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
66751220 .. 66751732
513 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21573

Sequence Viewer

Length: 219 bp
ATGCAATATAATTCATCAAAGTACGATATTCAAATGGCATTGCGGGATGAAATCAAAAGTGCGTGTGATTACCGTCCATTTGAGAAGTGTGATTACAGTTCAAGAATAGCTAACGAGATCTGTTGCAAGAAACTGGAATATGTCATGTTAAAGAACTCGATCGATGCAAAAACAACTGTTAGAACACTAGGCACTAATTGTACAATGTATTTAATATAA

Protein Analysis

72

Amino Acids

8.42

Weight (kDa)

8.28

Isoelectric Point (pI)

43.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 43
AfaI GTAC 2 cut(s) 23, 202
AgsI TTSAA 2 cut(s) 32, 102
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
BarI GAAGNNNNNNTAC 2 cut(s) 77, 109
BfaI CTAG 1 cut(s) 188
BglII AGATCT 1 cut(s) 117
BmsI GCATC 1 cut(s) 154
Bsa29I ATCGAT 1 cut(s) 162
Bse1I ACTGG 1 cut(s) 138
Bse3DI GCAATG 1 cut(s) 38
BseCI ATCGAT 1 cut(s) 162
BseGI GGATG 1 cut(s) 52
BseMI GCAATG 1 cut(s) 38
BseNI ACTGG 1 cut(s) 138
Bsh1285I CGRYCG 1 cut(s) 162
BshVI ATCGAT 1 cut(s) 162
BsiEI CGRYCG 1 cut(s) 162
Bsp1407I TGTACA 1 cut(s) 200
Bsp143I GATC 2 cut(s) 117, 159
BspACI CCGC 1 cut(s) 43
BspDI ATCGAT 1 cut(s) 162
BsrDI GCAATG 1 cut(s) 38
BsrGI TGTACA 1 cut(s) 200
BsrI ACTGG 1 cut(s) 138
BssMI GATC 2 cut(s) 117, 159
Bst4CI ACNGT 3 cut(s) 74, 98, 178
BstAUI TGTACA 1 cut(s) 200
BstF5I GGATG 1 cut(s) 52
BstKTI GATC 2 cut(s) 120, 162
BstMBI GATC 2 cut(s) 117, 159
BstMCI CGRYCG 1 cut(s) 162
BstX2I RGATCY 1 cut(s) 117
BstYI RGATCY 1 cut(s) 117
Bsu15I ATCGAT 1 cut(s) 162
BsuTUI ATCGAT 1 cut(s) 162
BtsCI GGATG 1 cut(s) 52
ClaI ATCGAT 1 cut(s) 162
Csp6I GTAC 2 cut(s) 22, 201
CviAII CATG 1 cut(s) 145
CviJI RGCY 1 cut(s) 110
CviKI_1 RGCY 1 cut(s) 110
CviQI GTAC 2 cut(s) 22, 201
DpnI GATC 2 cut(s) 119, 161
DpnII GATC 2 cut(s) 117, 159
FaeI CATG 1 cut(s) 148
FaiI YATR 4 cut(s) 9, 141, 146, 217
FatI CATG 1 cut(s) 144
FauI CCCGC 1 cut(s) 36
FokI GGATG 1 cut(s) 59
FspBI CTAG 1 cut(s) 188
FspEI CC 7 cut(s) 20, 28, 29, 86, 90, 119, 174
Hin1II CATG 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 102
HpyCH4III ACNGT 3 cut(s) 74, 98, 178
HpyCH4V TGCA 3 cut(s) 4, 126, 167
Hsp92II CATG 1 cut(s) 148
Kzo9I GATC 2 cut(s) 117, 159
LpnPI CCDG 1 cut(s) 119
LweI GCATC 1 cut(s) 154
MaeI CTAG 1 cut(s) 188
MalI GATC 2 cut(s) 119, 161
MboI GATC 2 cut(s) 117, 159
MflI RGATCY 1 cut(s) 117
MluCI AATT 2 cut(s) 10, 196
MseI TTAA 2 cut(s) 149, 212
NdeII GATC 2 cut(s) 117, 159
NlaIII CATG 1 cut(s) 148
Ple19I CGATCG 1 cut(s) 162
PsuI RGATCY 1 cut(s) 117
PvuI CGATCG 1 cut(s) 162
RsaI GTAC 2 cut(s) 23, 202
RsaNI GTAC 2 cut(s) 22, 201
SaqAI TTAA 2 cut(s) 149, 212
Sau3AI GATC 2 cut(s) 117, 159
SetI ASST 1 cut(s) 112
SfaNI GCATC 1 cut(s) 154
SgeI CNNG 9 cut(s) 56, 75, 114, 127, 139, 146, 157, 169, 200
Sse9I AATT 2 cut(s) 10, 196
SsiI CCGC 1 cut(s) 43
SspMI CTAG 1 cut(s) 188
TaaI ACNGT 3 cut(s) 74, 98, 178
TaqI TCGA 2 cut(s) 158, 162
TasI AATT 2 cut(s) 10, 196
TatI WGTACW 1 cut(s) 200
Tru1I TTAA 2 cut(s) 149, 212
Tru9I TTAA 2 cut(s) 149, 212
TspDTI ATGAA 1 cut(s) 63
XspI CTAG 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.