pycom01g07990

tRNA-specific adenosine deaminase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
8987995 .. 8989046
1052 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g07990.2

Sequence Viewer

Length: 216 bp
ATGTTGCTTCCATTTTCAGGTGATGCTTCACAACTAATTGGCTTGGTACAAAGAAAGCCTGGTCGCGGTGATACAACATTATCAGTTAGTTGCTCTGACAAGATAGCCCCCTGGAATGTTGTTGGAGTTAAAGACGTCTTATCAAGAAATCAAGGTATGGTCAATACTCCAGATACTGATTTACAGACTTCTTTATATAATATTTTGTTGATCTAG

Protein Analysis

72

Amino Acids

7.66

Weight (kDa)

5.94

Isoelectric Point (pI)

30.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 138
AccII CGCG 1 cut(s) 66
AciI CCGC 1 cut(s) 66
AcyI GRCGYC 1 cut(s) 135
AfaI GTAC 1 cut(s) 48
AfiI CCNNNNNNNGG 2 cut(s) 17, 65
AjnI CCWGG 2 cut(s) 58, 110
AlwNI CAGNNNCTG 1 cut(s) 176
AsuHPI GGTGA 2 cut(s) 32, 80
BciT130I CCWGG 2 cut(s) 60, 112
BfaI CTAG 1 cut(s) 214
Bme1390I CCNGG 2 cut(s) 60, 112
BmrFI CCNGG 2 cut(s) 60, 112
BmsI GCATC 1 cut(s) 13
BpmI CTGGAG 1 cut(s) 153
BsaHI GRCGYC 1 cut(s) 135
BsaJI CCNNGG 1 cut(s) 110
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 65
BseBI CCWGG 2 cut(s) 60, 112
BseDI CCNNGG 1 cut(s) 110
BseLI CCNNNNNNNGG 2 cut(s) 17, 65
Bsh1236I CGCG 1 cut(s) 66
BslI CCNNNNNNNGG 2 cut(s) 17, 65
Bsp143I GATC 1 cut(s) 210
BspACI CCGC 1 cut(s) 66
BspFNI CGCG 1 cut(s) 66
BssECI CCNNGG 1 cut(s) 110
BssMI GATC 1 cut(s) 210
BssNI GRCGYC 1 cut(s) 135
Bst2UI CCWGG 2 cut(s) 60, 112
BstACI GRCGYC 1 cut(s) 135
BstFNI CGCG 1 cut(s) 66
BstKTI GATC 1 cut(s) 213
BstMBI GATC 1 cut(s) 210
BstNI CCWGG 2 cut(s) 60, 112
BstSCI CCNGG 2 cut(s) 58, 110
BstUI CGCG 1 cut(s) 66
CaiI CAGNNNCTG 1 cut(s) 176
Csp6I GTAC 1 cut(s) 47
CviJI RGCY 3 cut(s) 42, 58, 107
CviKI_1 RGCY 3 cut(s) 42, 58, 107
CviQI GTAC 1 cut(s) 47
DpnI GATC 1 cut(s) 212
DpnII GATC 1 cut(s) 210
EcoRII CCWGG 2 cut(s) 58, 110
FaiI YATR 3 cut(s) 158, 196, 198
FspBI CTAG 1 cut(s) 214
GsuI CTGGAG 1 cut(s) 153
Hin1I GRCGYC 1 cut(s) 135
HphI GGTGA 2 cut(s) 32, 80
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 2 cut(s) 144, 170
HpyCH4IV ACGT 1 cut(s) 135
HpySE526I ACGT 1 cut(s) 135
Hsp92I GRCGYC 1 cut(s) 135
Kzo9I GATC 1 cut(s) 210
LpnPI CCDG 6 cut(s) 3, 45, 72, 97, 124, 183
LweI GCATC 1 cut(s) 13
MaeI CTAG 1 cut(s) 214
MaeII ACGT 1 cut(s) 135
MalI GATC 1 cut(s) 212
MboI GATC 1 cut(s) 210
MluCI AATT 1 cut(s) 36
MmeI TCCRAC 1 cut(s) 103
MseI TTAA 1 cut(s) 129
MspR9I CCNGG 2 cut(s) 60, 112
MvaI CCWGG 2 cut(s) 60, 112
MvnI CGCG 1 cut(s) 66
NdeII GATC 1 cut(s) 210
Psp6I CCWGG 2 cut(s) 58, 110
PspGI CCWGG 2 cut(s) 58, 110
PstNI CAGNNNCTG 1 cut(s) 176
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SaqAI TTAA 1 cut(s) 129
Sau3AI GATC 1 cut(s) 210
ScrFI CCNGG 2 cut(s) 60, 112
SetI ASST 3 cut(s) 22, 138, 157
SfaNI GCATC 1 cut(s) 13
Sse9I AATT 1 cut(s) 36
SsiI CCGC 1 cut(s) 66
SspI AATATT 1 cut(s) 202
SspMI CTAG 1 cut(s) 214
StyD4I CCNGG 2 cut(s) 58, 110
TaiI ACGT 1 cut(s) 138
TasI AATT 1 cut(s) 36
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
XspI CTAG 1 cut(s) 214
ZraI GACGTC 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.