pycom03g19590

Adipose-regulatory protein, Seipin

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
Physical Location & Seq
Reverse (-)
20168382 .. 20168767
386 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g19590.1

Sequence Viewer

Length: 345 bp
ATGGCCGAGTTCTTGTCAGCAGACGGCAGTGTCACTGCTAGCTCAAGCTATCCGTGCGGGCCAATTCACTTCACTGAAACATTTCTCAAAACCACTCCTCTCATTGCCGGTTTACAATCAGGAACCCAAGTTCTGAACATAAAAACGATTGAACACATTGAAGGGCTGCAAGTGTTCCAAAATGGTGCGGGCATACCTCAAATTTACGCTGCATCACTAGAGCTTGAATATGAGCTTCCTCGGTTGAAAAGATTTTTCAACATCAGTCTTGGTTGTTTGCTTCCAGTCTGGTATTGGAATCTGGCCGGAAGCTTTCATAGGTTTCATTTGCTCTTATGTAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

12.67

Weight (kDa)

6.02

Isoelectric Point (pI)

48.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Seipin PF06775 2 - 85 2.2e-06 Putative adipose-regulatory protein (Seipin)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 29
AciI CCGC 2 cut(s) 57, 188
AcoI YGGCCR 2 cut(s) 3, 303
AcsI RAATTY 1 cut(s) 201
AgsI TTSAA 5 cut(s) 152, 161, 227, 247, 259
AloI GAACNNNNNNTCC 2 cut(s) 114, 146
AluBI AGCT 5 cut(s) 42, 48, 223, 235, 312
AluI AGCT 5 cut(s) 42, 48, 223, 235, 312
AoxI GGCC 3 cut(s) 3, 59, 303
ApeKI GCWGC 2 cut(s) 166, 209
ApoI RAATTY 1 cut(s) 201
Asp700I GAANNNNTTC 1 cut(s) 81
AspS9I GGNCC 1 cut(s) 59
AsuNHI GCTAGC 1 cut(s) 38
BbvI GCAGC 2 cut(s) 153, 196
BceAI ACGGC 1 cut(s) 40
BfaI CTAG 2 cut(s) 39, 218
BisI GCNGC 2 cut(s) 167, 210
BlsI GCNGC 2 cut(s) 168, 211
BmgT120I GGNCC 1 cut(s) 59
BmiI GGNNCC 1 cut(s) 124
BmsI GCATC 1 cut(s) 221
BmtI GCTAGC 1 cut(s) 42
BpuEI CTTGAG 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 239
Bse118I RCCGGY 1 cut(s) 107
Bse1I ACTGG 1 cut(s) 284
Bse3DI GCAATG 1 cut(s) 102
BseDI CCNNGG 1 cut(s) 239
BseMI GCAATG 1 cut(s) 102
BseNI ACTGG 1 cut(s) 284
BseRI GAGGAG 1 cut(s) 87
BseXI GCAGC 2 cut(s) 153, 196
BshFI GGCC 3 cut(s) 5, 61, 305
BsiSI CCGG 2 cut(s) 108, 306
BsnI GGCC 3 cut(s) 5, 61, 305
BspACI CCGC 2 cut(s) 57, 188
BspANI GGCC 3 cut(s) 5, 61, 305
BspLI GGNNCC 1 cut(s) 124
BspOI GCTAGC 1 cut(s) 42
BsrDI GCAATG 1 cut(s) 102
BsrFI RCCGGY 1 cut(s) 107
BsrI ACTGG 1 cut(s) 284
BssAI RCCGGY 1 cut(s) 107
BssECI CCNNGG 1 cut(s) 239
BstC8I GCNNGC 3 cut(s) 40, 59, 190
BstMWI GCNNNNNNNGC 1 cut(s) 54
BstV1I GCAGC 2 cut(s) 153, 196
BsuRI GGCC 3 cut(s) 5, 61, 305
BtsI GCAGTG 2 cut(s) 33, 34
BtsIMutI CAGTG 3 cut(s) 33, 34, 72
Cac8I GCNNGC 3 cut(s) 40, 59, 190
Cfr10I RCCGGY 1 cut(s) 107
Cfr13I GGNCC 1 cut(s) 59
CviJI RGCY 9 cut(s) 5, 42, 48, 61, 166, 223, 235, 305, 312
CviKI_1 RGCY 9 cut(s) 5, 42, 48, 61, 166, 223, 235, 305, 312
DrdI GACNNNNNNGTC 1 cut(s) 29
DseDI GACNNNNNNGTC 1 cut(s) 29
EaeI YGGCCR 2 cut(s) 3, 303
FaiI YATR 5 cut(s) 140, 194, 231, 318, 337
FauI CCCGC 2 cut(s) 50, 181
Fnu4HI GCNGC 2 cut(s) 167, 210
Fsp4HI GCNGC 2 cut(s) 167, 210
FspBI CTAG 2 cut(s) 39, 218
GluI GCNGC 2 cut(s) 167, 210
HaeIII GGCC 3 cut(s) 5, 61, 305
HapII CCGG 2 cut(s) 108, 306
HindIII AAGCTT 1 cut(s) 310
HinfI GANTC 1 cut(s) 298
HpaII CCGG 2 cut(s) 108, 306
Hpy166II GTNNAC 1 cut(s) 113
Hpy188I TCNGA 1 cut(s) 135
Hpy188III TCNNGA 1 cut(s) 120
Hpy8I GTNNAC 1 cut(s) 113
HpyAV CCTTC 1 cut(s) 155
HpyCH4V TGCA 2 cut(s) 169, 212
HpyF10VI GCNNNNNNNGC 1 cut(s) 54
LpnPI CCDG 6 cut(s) 105, 121, 274, 287, 297, 319
Lsp1109I GCAGC 2 cut(s) 153, 196
LweI GCATC 1 cut(s) 221
MaeI CTAG 2 cut(s) 39, 218
MaeIII GTNAC 1 cut(s) 31
MluCI AATT 3 cut(s) 63, 201, 340
MnlI CCTC 3 cut(s) 108, 207, 249
MroXI GAANNNNTTC 1 cut(s) 81
MspI CCGG 2 cut(s) 108, 306
MwoI GCNNNNNNNGC 1 cut(s) 54
NheI GCTAGC 1 cut(s) 38
NlaIV GGNNCC 1 cut(s) 124
NmeAIII GCCGAG 1 cut(s) 31
NmuCI GTSAC 1 cut(s) 31
PdmI GAANNNNTTC 1 cut(s) 81
PfeI GAWTC 1 cut(s) 298
PkrI GCNGC 2 cut(s) 168, 211
PspN4I GGNNCC 1 cut(s) 124
PspPI GGNCC 1 cut(s) 59
SatI GCNGC 2 cut(s) 167, 210
Sau96I GGNCC 1 cut(s) 59
SetI ASST 7 cut(s) 44, 50, 199, 225, 237, 314, 323
SfaNI GCATC 1 cut(s) 221
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 3 cut(s) 63, 201, 340
SsiI CCGC 2 cut(s) 57, 188
SspMI CTAG 2 cut(s) 39, 218
TasI AATT 3 cut(s) 63, 201, 340
TfiI GAWTC 1 cut(s) 298
TscAI CASTG 3 cut(s) 34, 40, 79
TseFI GTSAC 1 cut(s) 31
TseI GCWGC 2 cut(s) 166, 209
Tsp45I GTSAC 1 cut(s) 31
TspDTI ATGAA 2 cut(s) 305, 314
TspGWI ACGGA 1 cut(s) 42
TspRI CASTG 3 cut(s) 34, 40, 79
XapI RAATTY 1 cut(s) 201
XcmI CCANNNNNNNNNTGG 1 cut(s) 291
XmnI GAANNNNTTC 1 cut(s) 81
XspI CTAG 2 cut(s) 39, 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.