RLG00000033207

Putative adipose-regulatory protein (Seipin)

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
24483866 .. 24485687
1822 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000033207

Sequence Viewer

Length: 426 bp
ATGCTCAAATTGGCTCTGGATGGGGCTGACAAGGTGTTCAAGGATCATAGAACACTGAATAGTAACATATCTGTACTTCGATGTCGAGCTAGATTTGCTGGTGATCATGGAGGAGAAAGGAGGTCTAGTCTGGATTCTACCCAAGTATTTGAAGAAAATGTTGTTGAAGAAAGAAGAGATGGAGCTATAAGTCCCCCTTCGGAGGGAAACAAACCTGCTAACCCTTTGCTACATCATCAATCGAGCAAAGATTGCGTTAATGTATCACAAGTGGTAAATTCTTCTTCAAGGAACTATGATCCATTTCCTTTGAACATTTTGGCCTTCATTATGGGGATTCTGGCATCTGGATTTGTGCTTAGTGGGTTTGTGATGAAACACCTGGTTGAGAAGCCTATTAAGACCATAGAGAACTCTCAACTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

142

Amino Acids

15.56

Weight (kDa)

7.85

Isoelectric Point (pI)

57.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 223
AclWI GGATC 2 cut(s) 51, 293
AcsI RAATTY 1 cut(s) 277
AfaI GTAC 1 cut(s) 75
AfiI CCNNNNNNNGG 2 cut(s) 202, 203
AgsI TTSAA 5 cut(s) 40, 152, 167, 288, 313
AjnI CCWGG 1 cut(s) 381
AluBI AGCT 2 cut(s) 89, 185
AluI AGCT 2 cut(s) 89, 185
AlwI GGATC 2 cut(s) 51, 293
AoxI GGCC 1 cut(s) 321
ApoI RAATTY 1 cut(s) 277
AsuHPI GGTGA 1 cut(s) 113
BccI CCATC 2 cut(s) 14, 173
BciT130I CCWGG 1 cut(s) 383
BclI TGATCA 1 cut(s) 103
BfaI CTAG 2 cut(s) 90, 126
BfuAI ACCTGC 1 cut(s) 223
Bme1390I CCNGG 1 cut(s) 383
BmrFI CCNGG 1 cut(s) 383
BmsI GCATC 1 cut(s) 353
BsaXI ACNNNNNCTCC 2 cut(s) 112, 142
Bsc4I CCNNNNNNNGG 2 cut(s) 202, 203
BseBI CCWGG 1 cut(s) 383
BseGI GGATG 1 cut(s) 25
BseLI CCNNNNNNNGG 2 cut(s) 202, 203
BseRI GAGGAG 1 cut(s) 126
BshFI GGCC 1 cut(s) 323
BslFI GGGAC 1 cut(s) 177
BslI CCNNNNNNNGG 2 cut(s) 202, 203
BsmFI GGGAC 1 cut(s) 177
BsnI GGCC 1 cut(s) 323
Bsp143I GATC 3 cut(s) 43, 103, 298
BspANI GGCC 1 cut(s) 323
BspMI ACCTGC 1 cut(s) 223
BspPI GGATC 2 cut(s) 51, 293
BssMI GATC 3 cut(s) 43, 103, 298
Bst2UI CCWGG 1 cut(s) 383
Bst6I CTCTTC 1 cut(s) 169
BstAPI GCANNNNNTGC 1 cut(s) 252
BstDEI CTNAG 1 cut(s) 359
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 3 cut(s) 46, 106, 301
BstMBI GATC 3 cut(s) 43, 103, 298
BstMWI GCNNNNNNNGC 2 cut(s) 95, 252
BstNI CCWGG 1 cut(s) 383
BstSCI CCNGG 1 cut(s) 381
BsuRI GGCC 1 cut(s) 323
BtsCI GGATG 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 53
BveI ACCTGC 1 cut(s) 223
CsiI ACCWGGT 1 cut(s) 381
Csp6I GTAC 1 cut(s) 74
CviAII CATG 1 cut(s) 107
CviJI RGCY 6 cut(s) 14, 26, 89, 185, 323, 394
CviKI_1 RGCY 6 cut(s) 14, 26, 89, 185, 323, 394
CviQI GTAC 1 cut(s) 74
DdeI CTNAG 1 cut(s) 359
DpnI GATC 3 cut(s) 45, 105, 300
DpnII GATC 3 cut(s) 43, 103, 298
Eam1104I CTCTTC 1 cut(s) 169
EarI CTCTTC 1 cut(s) 169
EcoRII CCWGG 1 cut(s) 381
FaeI CATG 1 cut(s) 110
FaiI YATR 7 cut(s) 48, 68, 108, 188, 297, 332, 407
FalI AAGNNNNNCTT 2 cut(s) 181, 213
FaqI GGGAC 1 cut(s) 177
FatI CATG 1 cut(s) 106
FbaI TGATCA 1 cut(s) 103
FokI GGATG 1 cut(s) 32
FspBI CTAG 2 cut(s) 90, 126
HaeIII GGCC 1 cut(s) 323
Hin1II CATG 1 cut(s) 110
HinfI GANTC 2 cut(s) 134, 337
HphI GGTGA 1 cut(s) 113
Hpy188I TCNGA 1 cut(s) 202
Hpy188III TCNNGA 3 cut(s) 17, 131, 348
HpyAV CCTTC 2 cut(s) 207, 334
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 252
HpyF3I CTNAG 1 cut(s) 359
Hsp92II CATG 1 cut(s) 110
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 3 cut(s) 43, 103, 298
LmnI GCTCC 1 cut(s) 182
LpnPI CCDG 8 cut(s) 2, 84, 116, 228, 326, 333, 368, 395
LweI GCATC 1 cut(s) 353
MabI ACCWGGT 1 cut(s) 381
MaeI CTAG 2 cut(s) 90, 126
MaeIII GTNAC 1 cut(s) 62
MalI GATC 3 cut(s) 45, 105, 300
MboI GATC 3 cut(s) 43, 103, 298
MboII GAAGA 5 cut(s) 164, 179, 186, 273, 276
MluCI AATT 2 cut(s) 8, 277
MnlI CCTC 3 cut(s) 104, 114, 196
MseI TTAA 2 cut(s) 258, 399
MspR9I CCNGG 1 cut(s) 383
MvaI CCWGG 1 cut(s) 383
MwoI GCNNNNNNNGC 2 cut(s) 95, 252
NdeII GATC 3 cut(s) 43, 103, 298
NlaIII CATG 1 cut(s) 110
PfeI GAWTC 2 cut(s) 134, 337
Psp6I CCWGG 1 cut(s) 381
PspGI CCWGG 1 cut(s) 381
RsaI GTAC 1 cut(s) 75
RsaNI GTAC 1 cut(s) 74
SaqAI TTAA 2 cut(s) 258, 399
Sau3AI GATC 3 cut(s) 43, 103, 298
ScrFI CCNGG 1 cut(s) 383
SetI ASST 6 cut(s) 36, 91, 125, 187, 217, 384
SexAI ACCWGGT 1 cut(s) 381
SfaNI GCATC 1 cut(s) 353
Sse9I AATT 2 cut(s) 8, 277
SspMI CTAG 2 cut(s) 90, 126
StyD4I CCNGG 1 cut(s) 381
TaqI TCGA 3 cut(s) 79, 85, 242
TasI AATT 2 cut(s) 8, 277
TatI WGTACW 1 cut(s) 73
TfiI GAWTC 2 cut(s) 134, 337
Tru1I TTAA 2 cut(s) 258, 399
Tru9I TTAA 2 cut(s) 258, 399
TscAI CASTG 1 cut(s) 60
TspDTI ATGAA 2 cut(s) 316, 389
TspRI CASTG 1 cut(s) 60
XapI RAATTY 1 cut(s) 277
XspI CTAG 2 cut(s) 90, 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.