pycom05g22950

DCD

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
OG0003630
Physical Location & Seq
Forward (+)
25058550 .. 25058849
300 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g22950.1

Sequence Viewer

Length: 300 bp
ATGGACGATGCAAAGGATTTTCTCCCAATCAGCGGCAGTAATTCTTGCAAAAGCTCATACACTGCGACCTCTGAGAGTGCGGAAGCAAGGGAGGATGTTCTTCAAAGCAACGTTGAAATCGGAAAAGGTGAACTCAAGACGGCCTGCAGCCAAAATACAAGTTTAGCTCATGATTTTGAGTTTGATGATGATAGTAAAACTGATGATACTGAAAGAGAAAACAAGAGGCTTTGGAGTATTCTAACGGCCAGGTTGAAGCAGCTGAAGAATGCTCAACAAACAACACTGACAAGGTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dev_Cell_Death

Protein Analysis

100

Amino Acids

11.02

Weight (kDa)

4.8

Isoelectric Point (pI)

52.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 33, 80
AclI AACGTT 1 cut(s) 111
AcoI YGGCCR 1 cut(s) 246
AcuI CTGAAG 1 cut(s) 284
AfiI CCNNNNNNNGG 1 cut(s) 32
AgsI TTSAA 3 cut(s) 104, 116, 256
AjnI CCWGG 1 cut(s) 248
AluBI AGCT 3 cut(s) 54, 167, 262
AluI AGCT 3 cut(s) 54, 167, 262
AoxI GGCC 2 cut(s) 141, 246
ApeKI GCWGC 2 cut(s) 147, 259
AspS9I GGNCC 1 cut(s) 294
AsuHPI GGTGA 1 cut(s) 140
AvaII GGWCC 1 cut(s) 294
BbvI GCAGC 2 cut(s) 159, 271
BceAI ACGGC 2 cut(s) 156, 261
BciT130I CCWGG 1 cut(s) 250
BfaI CTAG 1 cut(s) 298
BfmI CTRYAG 1 cut(s) 145
BisI GCNGC 3 cut(s) 34, 148, 260
BlsI GCNGC 3 cut(s) 35, 149, 261
Bme1390I CCNGG 1 cut(s) 250
Bme18I GGWCC 1 cut(s) 294
BmgT120I GGNCC 1 cut(s) 294
BmrFI CCNGG 1 cut(s) 250
BpuEI CTTGAG 1 cut(s) 119
Bsc4I CCNNNNNNNGG 1 cut(s) 32
BseBI CCWGG 1 cut(s) 250
BseGI GGATG 1 cut(s) 100
BseLI CCNNNNNNNGG 1 cut(s) 32
BseMII CTCAG 1 cut(s) 63
BseXI GCAGC 2 cut(s) 159, 271
BshFI GGCC 2 cut(s) 143, 248
BslI CCNNNNNNNGG 1 cut(s) 32
BsmI GAATGC 1 cut(s) 274
BsnI GGCC 2 cut(s) 143, 248
BspACI CCGC 2 cut(s) 33, 80
BspANI GGCC 2 cut(s) 143, 248
BspCNI CTCAG 1 cut(s) 64
BspHI TCATGA 1 cut(s) 169
BspMAI CTGCAG 1 cut(s) 149
Bst2UI CCWGG 1 cut(s) 250
BstC8I GCNNGC 1 cut(s) 145
BstDEI CTNAG 1 cut(s) 72
BstF5I GGATG 1 cut(s) 100
BstNI CCWGG 1 cut(s) 250
BstSCI CCNGG 1 cut(s) 248
BstSFI CTRYAG 1 cut(s) 145
BstV1I GCAGC 2 cut(s) 159, 271
BsuRI GGCC 2 cut(s) 143, 248
BtsCI GGATG 1 cut(s) 100
BtsI GCAGTG 1 cut(s) 60
BtsIMutI CAGTG 2 cut(s) 60, 284
Cac8I GCNNGC 1 cut(s) 145
CciI TCATGA 1 cut(s) 169
Cfr13I GGNCC 1 cut(s) 294
CviAII CATG 1 cut(s) 170
CviJI RGCY 7 cut(s) 54, 143, 150, 167, 229, 248, 262
CviKI_1 RGCY 7 cut(s) 54, 143, 150, 167, 229, 248, 262
DdeI CTNAG 1 cut(s) 72
EaeI YGGCCR 1 cut(s) 246
Eco47I GGWCC 1 cut(s) 294
Eco57I CTGAAG 1 cut(s) 284
EcoO109I RGGNCCY 1 cut(s) 294
EcoRII CCWGG 1 cut(s) 248
FaeI CATG 1 cut(s) 173
FaiI YATR 2 cut(s) 58, 171
FatI CATG 1 cut(s) 169
Fnu4HI GCNGC 3 cut(s) 34, 148, 260
FokI GGATG 1 cut(s) 107
Fsp4HI GCNGC 3 cut(s) 34, 148, 260
FspBI CTAG 1 cut(s) 298
GluI GCNGC 3 cut(s) 34, 148, 260
HaeIII GGCC 2 cut(s) 143, 248
Hin1II CATG 1 cut(s) 173
HphI GGTGA 1 cut(s) 140
Hpy166II GTNNAC 1 cut(s) 131
Hpy188I TCNGA 2 cut(s) 73, 122
Hpy188III TCNNGA 2 cut(s) 136, 170
Hpy8I GTNNAC 1 cut(s) 131
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 3 cut(s) 11, 48, 147
HpyF3I CTNAG 1 cut(s) 72
HpySE526I ACGT 1 cut(s) 111
Hsp92II CATG 1 cut(s) 173
LpnPI CCDG 3 cut(s) 157, 235, 262
Lsp1109I GCAGC 2 cut(s) 159, 271
MaeI CTAG 1 cut(s) 298
MaeII ACGT 1 cut(s) 111
MboII GAAGA 2 cut(s) 92, 277
MluCI AATT 1 cut(s) 40
MnlI CCTC 3 cut(s) 79, 85, 219
MspA1I CMGCKG 2 cut(s) 33, 262
MspR9I CCNGG 1 cut(s) 250
Mva1269I GAATGC 1 cut(s) 274
MvaI CCWGG 1 cut(s) 250
NlaIII CATG 1 cut(s) 173
PagI TCATGA 1 cut(s) 169
PctI GAATGC 1 cut(s) 274
PflFI GACNNNGTC 1 cut(s) 292
PkrI GCNGC 3 cut(s) 35, 149, 261
PpuMI RGGWCCY 1 cut(s) 294
Psp1406I AACGTT 1 cut(s) 111
Psp5II RGGWCCY 1 cut(s) 294
Psp6I CCWGG 1 cut(s) 248
PspGI CCWGG 1 cut(s) 248
PspPI GGNCC 1 cut(s) 294
PspPPI RGGWCCY 1 cut(s) 294
PstI CTGCAG 1 cut(s) 149
PsyI GACNNNGTC 1 cut(s) 292
PvuII CAGCTG 1 cut(s) 262
SatI GCNGC 3 cut(s) 34, 148, 260
Sau96I GGNCC 1 cut(s) 294
ScrFI CCNGG 1 cut(s) 250
SetI ASST 8 cut(s) 56, 71, 114, 130, 169, 254, 264, 296
SfcI CTRYAG 1 cut(s) 145
SgeI CNNG 9 cut(s) 57, 99, 148, 156, 171, 182, 235, 261, 262
SinI GGWCC 1 cut(s) 294
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
Sse9I AATT 1 cut(s) 40
SsiI CCGC 2 cut(s) 33, 80
SspMI CTAG 1 cut(s) 298
StyD4I CCNGG 1 cut(s) 248
TaiI ACGT 1 cut(s) 114
TasI AATT 1 cut(s) 40
TauI GCSGC 1 cut(s) 36
TscAI CASTG 2 cut(s) 67, 291
TseI GCWGC 2 cut(s) 147, 259
TspRI CASTG 2 cut(s) 67, 291
Tth111I GACNNNGTC 1 cut(s) 292
VpaK11BI GGWCC 1 cut(s) 294
XspI CTAG 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.