pycom09g05440

rRNA (uridine-N3-)-methyltransferase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Reverse (-)
4058894 .. 4060696
1803 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 603 bp
ATGCTCAGCAAAGGTGGTGAAATTCATGTTTCACACATGGTAGGCTACCCGTATGATCAATGGAAGTTGAAGGAGCTTGCTGAGAAAGCAGGCCTGTTTTTGAAAGAGAAAGTGTGGTTCAACAAGTCAGACTACCCCGGTTACCACAGTAAGAGGGCTGGCGGCATCCAGAGCAACAAAATGTTTCGTCCGAATAAAAAAACATGTTACACCTTCAAATTTTCTCTGAAACAAACAAGTTCTGAACTTTCTGTTTGTAATCCCACAACCCGCATTGTAAGTGATGGCCCTTCACCACCTGGCTATCAGGGCTACCTTTGTCCTCCAGCTCCCCCAGGCCCCACACCCTCTCCCCGCCTAGACGATTATGAACCTCCAGCTCCCCCAAGCCCCACACCCTCTCCCCGCCTAGACGATTATGAACCTCCAGCTGCTCCAAGCCCACCCTTACCCCCTTCCTGCCAAGACGATGATGACCCTCCAGCTGCCCCGACCCCGCCTTCACGCCAAGTTGATGAAGACATCGGCTGCTACTCAGTCCTTAGAGGCTGTTTGTGTGCAATTTTTCGCTGCTGGCCGGATATTGGACGCTCGCTGCTTTAG
Functional Annotation
Pfam Domains
Protein Families

Protein Analysis

201

Amino Acids

22.01

Weight (kDa)

6.8

Isoelectric Point (pI)

68.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BMT5-like PF10354 1 - 52 4.5e-12 rRNA (uridine-N3-)-methyltransferase BTM5-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 162, 271, 355, 406, 497
AcoI YGGCCR 1 cut(s) 575
AcsI RAATTY 2 cut(s) 21, 218
AfiI CCNNNNNNNGG 1 cut(s) 584
AflIII ACRYGT 1 cut(s) 203
AgsI TTSAA 4 cut(s) 70, 103, 121, 217
AjnI CCWGG 2 cut(s) 298, 334
AluBI AGCT 5 cut(s) 76, 329, 380, 431, 485
AluI AGCT 5 cut(s) 76, 329, 380, 431, 485
AoxI GGCC 4 cut(s) 91, 286, 337, 575
ApeKI GCWGC 5 cut(s) 431, 485, 528, 570, 595
ApoI RAATTY 2 cut(s) 21, 218
AspS9I GGNCC 2 cut(s) 287, 338
AsuC2I CCSGG 1 cut(s) 138
AsuHPI GGTGA 2 cut(s) 29, 285
BbsI GAAGAC 1 cut(s) 525
BbvI GCAGC 5 cut(s) 418, 472, 515, 557, 582
BccI CCATC 1 cut(s) 278
BciT130I CCWGG 2 cut(s) 300, 336
BclI TGATCA 1 cut(s) 55
BcnI CCSGG 1 cut(s) 138
BfaI CTAG 2 cut(s) 359, 410
BisI GCNGC 6 cut(s) 163, 432, 486, 529, 571, 596
BlpI GCTNAGC 1 cut(s) 5
BlsI GCNGC 6 cut(s) 164, 433, 487, 530, 572, 597
Bme1390I CCNGG 3 cut(s) 138, 300, 336
BmgT120I GGNCC 2 cut(s) 287, 338
BmiI GGNNCC 1 cut(s) 340
BmrFI CCNGG 3 cut(s) 138, 300, 336
BmsI GCATC 1 cut(s) 174
BpiI GAAGAC 1 cut(s) 525
BpmI CTGGAG 4 cut(s) 309, 360, 411, 465
Bpu1102I GCTNAGC 1 cut(s) 5
BpuMI CCSGG 1 cut(s) 138
BsaJI CCNNGG 2 cut(s) 136, 334
BsaXI ACNNNNNCTCC 4 cut(s) 334, 364, 385, 415
Bsc4I CCNNNNNNNGG 1 cut(s) 584
BseBI CCWGG 2 cut(s) 300, 336
BseDI CCNNGG 2 cut(s) 136, 334
BseGI GGATG 1 cut(s) 165
BseLI CCNNNNNNNGG 1 cut(s) 584
BseMII CTCAG 3 cut(s) 19, 72, 549
BseXI GCAGC 5 cut(s) 418, 472, 515, 557, 582
BshFI GGCC 4 cut(s) 93, 288, 339, 577
BsiSI CCGG 2 cut(s) 138, 578
BslI CCNNNNNNNGG 1 cut(s) 584
BsnI GGCC 4 cut(s) 93, 288, 339, 577
Bsp143I GATC 1 cut(s) 55
Bsp1720I GCTNAGC 1 cut(s) 5
BspACI CCGC 5 cut(s) 162, 271, 355, 406, 497
BspANI GGCC 4 cut(s) 93, 288, 339, 577
BspCNI CTCAG 3 cut(s) 18, 73, 548
BspLI GGNNCC 1 cut(s) 340
BssECI CCNNGG 2 cut(s) 136, 334
BssMI GATC 1 cut(s) 55
Bst2UI CCWGG 2 cut(s) 300, 336
Bst4CI ACNGT 1 cut(s) 149
BstC8I GCNNGC 5 cut(s) 78, 91, 160, 575, 593
BstDEI CTNAG 4 cut(s) 5, 81, 535, 542
BstEII GGTNACC 1 cut(s) 140
BstF5I GGATG 1 cut(s) 165
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstMWI GCNNNNNNNGC 3 cut(s) 86, 171, 309
BstNI CCWGG 2 cut(s) 300, 336
BstNSI RCATGY 1 cut(s) 207
BstPI GGTNACC 1 cut(s) 140
BstSCI CCNGG 3 cut(s) 136, 298, 334
BstV1I GCAGC 5 cut(s) 418, 472, 515, 557, 582
BstV2I GAAGAC 1 cut(s) 525
BsuRI GGCC 4 cut(s) 93, 288, 339, 577
BtsCI GGATG 1 cut(s) 165
Cac8I GCNNGC 5 cut(s) 78, 91, 160, 575, 593
Cfr13I GGNCC 2 cut(s) 287, 338
CseI GACGC 1 cut(s) 597
CviAII CATG 3 cut(s) 26, 37, 204
DdeI CTNAG 4 cut(s) 5, 81, 535, 542
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
EaeI YGGCCR 1 cut(s) 575
Eco147I AGGCCT 1 cut(s) 93
Eco91I GGTNACC 1 cut(s) 140
EcoO109I RGGNCCY 1 cut(s) 338
EcoO65I GGTNACC 1 cut(s) 140
EcoRII CCWGG 2 cut(s) 298, 334
FaeI CATG 3 cut(s) 29, 40, 207
FaiI YATR 6 cut(s) 27, 38, 54, 205, 369, 420
FatI CATG 3 cut(s) 25, 36, 203
FauI CCCGC 4 cut(s) 278, 362, 413, 504
FbaI TGATCA 1 cut(s) 55
Fnu4HI GCNGC 6 cut(s) 163, 432, 486, 529, 571, 596
FokI GGATG 1 cut(s) 152
Fsp4HI GCNGC 6 cut(s) 163, 432, 486, 529, 571, 596
FspBI CTAG 2 cut(s) 359, 410
GluI GCNGC 6 cut(s) 163, 432, 486, 529, 571, 596
GsuI CTGGAG 4 cut(s) 309, 360, 411, 465
HaeIII GGCC 4 cut(s) 93, 288, 339, 577
HapII CCGG 2 cut(s) 138, 578
HgaI GACGC 1 cut(s) 597
Hin1II CATG 3 cut(s) 29, 40, 207
HpaII CCGG 2 cut(s) 138, 578
HphI GGTGA 2 cut(s) 29, 285
Hpy188I TCNGA 4 cut(s) 130, 192, 228, 244
Hpy188III TCNNGA 1 cut(s) 169
HpyAV CCTTC 5 cut(s) 64, 223, 300, 465, 510
HpyCH4III ACNGT 1 cut(s) 149
HpyCH4V TGCA 1 cut(s) 560
HpyF10VI GCNNNNNNNGC 3 cut(s) 86, 171, 309
HpyF3I CTNAG 4 cut(s) 5, 81, 535, 542
Hsp92II CATG 3 cut(s) 29, 40, 207
Ksp22I TGATCA 1 cut(s) 55
Kzo9I GATC 1 cut(s) 55
LmnI GCTCC 4 cut(s) 73, 334, 385, 439
Lsp1109I GCAGC 5 cut(s) 418, 472, 515, 557, 582
LweI GCATC 1 cut(s) 174
MaeI CTAG 2 cut(s) 359, 410
MaeIII GTNAC 2 cut(s) 140, 206
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MboII GAAGA 1 cut(s) 530
MluCI AATT 3 cut(s) 21, 218, 561
MnlI CCTC 8 cut(s) 147, 333, 358, 384, 409, 435, 489, 539
MspA1I CMGCKG 2 cut(s) 431, 485
MspI CCGG 2 cut(s) 138, 578
MspR9I CCNGG 3 cut(s) 138, 300, 336
MvaI CCWGG 2 cut(s) 300, 336
MwoI GCNNNNNNNGC 3 cut(s) 86, 171, 309
NciI CCSGG 1 cut(s) 138
NdeII GATC 1 cut(s) 55
NlaIII CATG 3 cut(s) 29, 40, 207
NlaIV GGNNCC 1 cut(s) 340
NspI RCATGY 1 cut(s) 207
PceI AGGCCT 1 cut(s) 93
PciI ACATGT 1 cut(s) 203
PkrI GCNGC 6 cut(s) 164, 433, 487, 530, 572, 597
PscI ACATGT 1 cut(s) 203
Psp6I CCWGG 2 cut(s) 298, 334
PspEI GGTNACC 1 cut(s) 140
PspGI CCWGG 2 cut(s) 298, 334
PspN4I GGNNCC 1 cut(s) 340
PspPI GGNCC 2 cut(s) 287, 338
PvuII CAGCTG 2 cut(s) 431, 485
SatI GCNGC 6 cut(s) 163, 432, 486, 529, 571, 596
Sau3AI GATC 1 cut(s) 55
Sau96I GGNCC 2 cut(s) 287, 338
ScrFI CCNGG 3 cut(s) 138, 300, 336
SfaNI GCATC 1 cut(s) 174
Sse9I AATT 3 cut(s) 21, 218, 561
SseBI AGGCCT 1 cut(s) 93
SsiI CCGC 5 cut(s) 162, 271, 355, 406, 497
SspMI CTAG 2 cut(s) 359, 410
StuI AGGCCT 1 cut(s) 93
StyD4I CCNGG 3 cut(s) 136, 298, 334
TaaI ACNGT 1 cut(s) 149
TasI AATT 3 cut(s) 21, 218, 561
TauI GCSGC 1 cut(s) 165
TseI GCWGC 5 cut(s) 431, 485, 528, 570, 595
TspDTI ATGAA 4 cut(s) 14, 384, 435, 531
XapI RAATTY 2 cut(s) 21, 218
XceI RCATGY 1 cut(s) 207
XspI CTAG 2 cut(s) 359, 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.