pycom09g17330

Seed storage protein. Accumulates during seed development and is hydrolyzed after germination to provide a carbon and nitrogen source for the developing seedling

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
17804752 .. 17805357
606 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGAAAAGAAGAGAACAATGTGTTTGTACGCTTCTGATTAAACACAAAAAGGAGTCCTTCAACGTCGAACATGAAGATGTAATTGAAGTTTCTATAGAAGTTACTAAATACTTAATTAACAATGACAATGATGTATCCCTTCACATTGCAAAGCTCATCCCCTCCGTTAGCAATTCTGGACAATTTGAGCGATTATCGCATAAACCCAATTAA

Protein Analysis

71

Amino Acids

8.1

Weight (kDa)

6.9

Isoelectric Point (pI)

54.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 28
AgsI TTSAA 2 cut(s) 61, 86
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
BciVI GTATCC 1 cut(s) 145
BfmI CTRYAG 1 cut(s) 93
BfuI GTATCC 1 cut(s) 145
Bse3DI GCAATG 1 cut(s) 144
BseGI GGATG 1 cut(s) 156
BseMI GCAATG 1 cut(s) 144
BsrDI GCAATG 1 cut(s) 144
Bst6I CTCTTC 1 cut(s) 4
BstF5I GGATG 1 cut(s) 156
BstMWI GCNNNNNNNGC 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 93
BsuI GTATCC 1 cut(s) 145
BtsCI GGATG 1 cut(s) 156
Csp6I GTAC 1 cut(s) 27
CviAII CATG 1 cut(s) 71
CviJI RGCY 1 cut(s) 154
CviKI_1 RGCY 1 cut(s) 154
CviQI GTAC 1 cut(s) 27
Eam1104I CTCTTC 1 cut(s) 4
EarI CTCTTC 1 cut(s) 4
FaeI CATG 1 cut(s) 74
FaiI YATR 3 cut(s) 72, 95, 201
FalI AAGNNNNNCTT 2 cut(s) 41, 73
FatI CATG 1 cut(s) 70
FokI GGATG 1 cut(s) 143
FspEI CC 9 cut(s) 35, 70, 151, 152, 162, 173, 174, 175, 178
Hin1II CATG 1 cut(s) 74
HinfI GANTC 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 36
Hpy188III TCNNGA 1 cut(s) 177
Hpy99I CGWCG 1 cut(s) 68
HpyAV CCTTC 2 cut(s) 67, 149
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 1 cut(s) 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 196
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 1 cut(s) 74
LpnPI CCDG 1 cut(s) 162
MaeII ACGT 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 100
MboII GAAGA 2 cut(s) 21, 86
MluCI AATT 5 cut(s) 81, 114, 172, 182, 208
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 1 cut(s) 172
MseI TTAA 4 cut(s) 39, 113, 117, 211
MslI CAYNNNNRTG 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 196
NlaIII CATG 1 cut(s) 74
PacI TTAATTAA 1 cut(s) 117
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
RseI CAYNNNNRTG 1 cut(s) 75
SaqAI TTAA 4 cut(s) 39, 113, 117, 211
SchI GAGTC 1 cut(s) 62
SetI ASST 2 cut(s) 66, 156
SfcI CTRYAG 1 cut(s) 93
SgeI CNNG 2 cut(s) 83, 189
SmiMI CAYNNNNRTG 1 cut(s) 75
Sse9I AATT 5 cut(s) 81, 114, 172, 182, 208
TaiI ACGT 1 cut(s) 66
TaqI TCGA 1 cut(s) 66
TasI AATT 5 cut(s) 81, 114, 172, 182, 208
Tru1I TTAA 4 cut(s) 39, 113, 117, 211
Tru9I TTAA 4 cut(s) 39, 113, 117, 211
TspDTI ATGAA 2 cut(s) 17, 87
TspGWI ACGGA 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.