pycom12g02910

Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion (By similarity)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
2620268 .. 2621060
793 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g02910.2

Sequence Viewer

Length: 369 bp
ATGATGACATGCCTAGCTTTCAGCACGTTTTTCCTAATAGCAATGTCAATTGTAGCTGGCTACTTGGTGCTCTCACTTCCCTTCTCCATCGTCTCCATCGTTCGCCCCCATGCAAGTGGACCAAGGCTCTTGCTTCTCATCCTTGACCTTGTGGCACTGACTCTAGTCACTTCTGCTGCTGGGGCTGCAACATCCATAGTCTACCTAGCCCACAATGGCAATGCAAGCTCCAACTGGCTAGCCATCTGCAACCAGTTTGGTGATTTCTGCCGGAACGTGAGTGGGGCTGTGGTGGCTTCCTTCGTTACTGTCGTCACCTTCATGTTCTTGATTCTGCTCTCTGCTTTGGCTCTCCGAAAGCATCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

12.99

Weight (kDa)

9.1

Isoelectric Point (pI)

18.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 201
AluBI AGCT 3 cut(s) 17, 56, 228
AluI AGCT 3 cut(s) 17, 56, 228
Alw21I GWGCWC 1 cut(s) 72
Alw26I GTCTC 1 cut(s) 97
ApeKI GCWGC 2 cut(s) 176, 185
AspS9I GGNCC 1 cut(s) 119
AsuHPI GGTGA 2 cut(s) 272, 307
AsuNHI GCTAGC 1 cut(s) 238
AvaII GGWCC 1 cut(s) 119
Bbv12I GWGCWC 1 cut(s) 72
BbvI GCAGC 2 cut(s) 163, 172
BccI CCATC 3 cut(s) 95, 104, 251
BcoDI GTCTC 1 cut(s) 97
BfaI CTAG 4 cut(s) 14, 164, 206, 239
BisI GCNGC 2 cut(s) 177, 186
BlsI GCNGC 2 cut(s) 178, 187
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmtI GCTAGC 1 cut(s) 242
BoxI GACNNNNGTC 1 cut(s) 164
BsaJI CCNNGG 1 cut(s) 122
Bse1I ACTGG 2 cut(s) 239, 253
Bse3DI GCAATG 2 cut(s) 48, 226
BseDI CCNNGG 1 cut(s) 122
BseGI GGATG 2 cut(s) 138, 191
BseMI GCAATG 2 cut(s) 48, 226
BseNI ACTGG 2 cut(s) 239, 253
BseXI GCAGC 2 cut(s) 163, 172
BseYI CCCAGC 1 cut(s) 179
BsiHKAI GWGCWC 1 cut(s) 72
BsiSI CCGG 1 cut(s) 271
BsmAI GTCTC 1 cut(s) 97
BsmBI CGTCTC 1 cut(s) 97
Bsp1286I GDGCHC 1 cut(s) 72
BspOI GCTAGC 1 cut(s) 242
BsrDI GCAATG 2 cut(s) 48, 226
BsrI ACTGG 2 cut(s) 239, 253
BssECI CCNNGG 1 cut(s) 122
BssT1I CCWWGG 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 310
BstC8I GCNNGC 3 cut(s) 58, 226, 240
BstF5I GGATG 2 cut(s) 138, 191
BstMAI GTCTC 1 cut(s) 97
BstMWI GCNNNNNNNGC 4 cut(s) 182, 185, 225, 293
BstNSI RCATGY 1 cut(s) 12
BstPAI GACNNNNGTC 1 cut(s) 164
BstV1I GCAGC 2 cut(s) 163, 172
BstXI CCANNNNNNTGG 1 cut(s) 116
BtsCI GGATG 2 cut(s) 138, 191
BtsIMutI CAGTG 2 cut(s) 155, 364
Cac8I GCNNGC 3 cut(s) 58, 226, 240
Cfr13I GGNCC 1 cut(s) 119
CviAII CATG 3 cut(s) 9, 110, 322
Eco130I CCWWGG 1 cut(s) 122
Eco47I GGWCC 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 122
ErhI CCWWGG 1 cut(s) 122
Esp3I CGTCTC 1 cut(s) 97
FaeI CATG 3 cut(s) 12, 113, 325
FaiI YATR 4 cut(s) 10, 111, 197, 323
FatI CATG 3 cut(s) 8, 109, 321
FblI GTMKAC 1 cut(s) 201
Fnu4HI GCNGC 2 cut(s) 177, 186
FokI GGATG 2 cut(s) 125, 178
Fsp4HI GCNGC 2 cut(s) 177, 186
FspBI CTAG 4 cut(s) 14, 164, 206, 239
GluI GCNGC 2 cut(s) 177, 186
GsaI CCCAGC 1 cut(s) 183
HapII CCGG 1 cut(s) 271
Hin1II CATG 3 cut(s) 12, 113, 325
HinfI GANTC 2 cut(s) 160, 331
HpaII CCGG 1 cut(s) 271
HphI GGTGA 2 cut(s) 272, 307
Hpy166II GTNNAC 2 cut(s) 119, 202
Hpy188I TCNGA 1 cut(s) 356
Hpy188III TCNNGA 1 cut(s) 328
Hpy8I GTNNAC 2 cut(s) 119, 202
HpyAV CCTTC 3 cut(s) 91, 310, 328
HpyCH4III ACNGT 1 cut(s) 310
HpyCH4IV ACGT 2 cut(s) 26, 276
HpyCH4V TGCA 4 cut(s) 113, 188, 224, 249
HpyF10VI GCNNNNNNNGC 4 cut(s) 182, 185, 225, 293
HpySE526I ACGT 2 cut(s) 26, 276
Hsp92II CATG 3 cut(s) 12, 113, 325
LmnI GCTCC 1 cut(s) 233
LpnPI CCDG 5 cut(s) 42, 165, 220, 266, 284
Lsp1109I GCAGC 2 cut(s) 163, 172
MaeI CTAG 4 cut(s) 14, 164, 206, 239
MaeII ACGT 2 cut(s) 26, 276
MaeIII GTNAC 3 cut(s) 166, 304, 313
MfeI CAATTG 1 cut(s) 48
MhlI GDGCHC 1 cut(s) 72
MluCI AATT 1 cut(s) 48
MlyI GAGTC 1 cut(s) 154
MmeI TCCRAC 1 cut(s) 255
MslI CAYNNNNRTG 2 cut(s) 114, 320
MspI CCGG 1 cut(s) 271
MunI CAATTG 1 cut(s) 48
MwoI GCNNNNNNNGC 4 cut(s) 182, 185, 225, 293
NheI GCTAGC 1 cut(s) 238
NlaIII CATG 3 cut(s) 12, 113, 325
NmuCI GTSAC 2 cut(s) 166, 313
NspI RCATGY 1 cut(s) 12
PcsI WCGNNNNNNNCGW 2 cut(s) 96, 309
PfeI GAWTC 1 cut(s) 331
PkrI GCNGC 2 cut(s) 178, 187
PleI GAGTC 1 cut(s) 154
PpsI GAGTC 1 cut(s) 154
PshAI GACNNNNGTC 1 cut(s) 164
PspFI CCCAGC 1 cut(s) 179
PspPI GGNCC 1 cut(s) 119
RseI CAYNNNNRTG 2 cut(s) 114, 320
SatI GCNGC 2 cut(s) 177, 186
Sau96I GGNCC 1 cut(s) 119
SchI GAGTC 1 cut(s) 154
SduI GDGCHC 1 cut(s) 72
SetI ASST 8 cut(s) 19, 29, 58, 150, 207, 230, 279, 320
SinI GGWCC 1 cut(s) 119
SmiMI CAYNNNNRTG 2 cut(s) 114, 320
Sse9I AATT 1 cut(s) 48
SspMI CTAG 4 cut(s) 14, 164, 206, 239
StyI CCWWGG 1 cut(s) 122
TaaI ACNGT 1 cut(s) 310
TaiI ACGT 2 cut(s) 29, 279
TasI AATT 1 cut(s) 48
TfiI GAWTC 1 cut(s) 331
TscAI CASTG 1 cut(s) 162
TseFI GTSAC 2 cut(s) 166, 313
TseI GCWGC 2 cut(s) 176, 185
Tsp45I GTSAC 2 cut(s) 166, 313
TspDTI ATGAA 1 cut(s) 310
TspRI CASTG 1 cut(s) 162
VpaK11BI GGWCC 1 cut(s) 119
XceI RCATGY 1 cut(s) 12
XmiI GTMKAC 1 cut(s) 201
XspI CTAG 4 cut(s) 14, 164, 206, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.