pycom14g06430

ABC transporter A family member

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Reverse (-)
6344618 .. 6345793
1176 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g06430.2

Sequence Viewer

Length: 231 bp
ATGATTGGAGATCCTTCTATAGTCATTCTTGATGAGCCGTCAACAGGTATGGATCCAATTGCCCAAAGATTCATGTGGGAAGTGATATCTCGTCTATCAACCAGACGAGGAAAGACAGCAGTAATACTTACTACGCATAGCATGAATGAAGCTCAAGCACTTTGCACTCGTATGGGGATCATGGTGCCTTTTGACCTTACCAGTCTACTTGAAGCACTAATCTACTGTTGA

Protein Analysis

77

Amino Acids

8.46

Weight (kDa)

5.08

Isoelectric Point (pI)

38.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 184
AccI GTMKAC 1 cut(s) 205
AclWI GGATC 4 cut(s) 5, 47, 60, 185
AfiI CCNNNNNNNGG 1 cut(s) 44
AgsI TTSAA 1 cut(s) 212
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
AlwI GGATC 4 cut(s) 5, 47, 60, 185
BamHI GGATCC 1 cut(s) 52
BanI GGYRCC 1 cut(s) 184
BceAI ACGGC 1 cut(s) 22
BfmI CTRYAG 1 cut(s) 18
BmiI GGNNCC 2 cut(s) 54, 186
BpuEI CTTGAG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 1 cut(s) 44
Bse1I ACTGG 1 cut(s) 201
BseLI CCNNNNNNNGG 1 cut(s) 44
BseNI ACTGG 1 cut(s) 201
BshNI GGYRCC 1 cut(s) 184
BslI CCNNNNNNNGG 1 cut(s) 44
Bsp143I GATC 3 cut(s) 10, 52, 177
BspLI GGNNCC 2 cut(s) 54, 186
BspPI GGATC 4 cut(s) 5, 47, 60, 185
BspT107I GGYRCC 1 cut(s) 184
BsrI ACTGG 1 cut(s) 201
BssMI GATC 3 cut(s) 10, 52, 177
Bst4CI ACNGT 1 cut(s) 227
BstKTI GATC 3 cut(s) 13, 55, 180
BstMBI GATC 3 cut(s) 10, 52, 177
BstSFI CTRYAG 1 cut(s) 18
BstX2I RGATCY 2 cut(s) 10, 52
BstYI RGATCY 2 cut(s) 10, 52
CviAII CATG 3 cut(s) 73, 142, 181
CviJI RGCY 2 cut(s) 37, 152
CviKI_1 RGCY 2 cut(s) 37, 152
DpnI GATC 3 cut(s) 12, 54, 179
DpnII GATC 3 cut(s) 10, 52, 177
Eco32I GATATC 1 cut(s) 87
EcoRV GATATC 1 cut(s) 87
FaeI CATG 3 cut(s) 76, 145, 184
FaiI YATR 7 cut(s) 20, 50, 74, 138, 143, 173, 182
FatI CATG 3 cut(s) 72, 141, 180
FblI GTMKAC 1 cut(s) 205
Hin1II CATG 3 cut(s) 76, 145, 184
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HinfI GANTC 1 cut(s) 69
Hpy166II GTNNAC 2 cut(s) 42, 206
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 2 cut(s) 42, 206
HpyAV CCTTC 1 cut(s) 24
HpyCH4III ACNGT 1 cut(s) 227
HpyCH4V TGCA 1 cut(s) 165
Hsp92II CATG 3 cut(s) 76, 145, 184
Kzo9I GATC 3 cut(s) 10, 52, 177
LpnPI CCDG 3 cut(s) 30, 115, 214
MalI GATC 3 cut(s) 12, 54, 179
MboI GATC 3 cut(s) 10, 52, 177
MfeI CAATTG 1 cut(s) 57
MflI RGATCY 2 cut(s) 10, 52
MluCI AATT 1 cut(s) 57
MnlI CCTC 1 cut(s) 101
MslI CAYNNNNRTG 1 cut(s) 170
MunI CAATTG 1 cut(s) 57
NdeII GATC 3 cut(s) 10, 52, 177
NlaIII CATG 3 cut(s) 76, 145, 184
NlaIV GGNNCC 2 cut(s) 54, 186
PfeI GAWTC 1 cut(s) 69
PspN4I GGNNCC 2 cut(s) 54, 186
PsuI RGATCY 2 cut(s) 10, 52
RseI CAYNNNNRTG 1 cut(s) 170
Sau3AI GATC 3 cut(s) 10, 52, 177
SetI ASST 3 cut(s) 49, 154, 198
SfcI CTRYAG 1 cut(s) 18
SmiMI CAYNNNNRTG 1 cut(s) 170
SmlI CTYRAG 1 cut(s) 153
SmoI CTYRAG 1 cut(s) 153
Sse9I AATT 1 cut(s) 57
TaaI ACNGT 1 cut(s) 227
TasI AATT 1 cut(s) 57
TfiI GAWTC 1 cut(s) 69
TspDTI ATGAA 3 cut(s) 61, 158, 162
XmiI GTMKAC 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.