Rh3DG310900

ABC transporter A family member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
33378512 .. 33400417
21906 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG310900.1

Sequence Viewer

Length: 489 bp
ATGGATGAATTTTTCACATGCAAGCTAGTGATTCAGAATAATCATGTACAAGACAAGGGAAAACAAGTGGTGGTTGAAACTGAAGATGTTCCAACAACTGTAGCTAGAATCTCAAAGTTTGTAAAAGTCTCCAAGAAAAGTGTGGTTGCAACTCCTCTTCAAAGACAAGTGCAGAGACTCAAGGCTTACCGAGTTTTGATGAAGGCTGATCTTGATGGCGAAGTTAAAACTGTCCGACTATGGGAAACCCTAACTGGAAGGGAGCATCTGCTTTTTTATGGAAGACTTAAGAACCTCAAAGGTTCTGGATTAAGACAAGCAGTGGAAGAATTTTGTTTCTTTGCAATTTCACTGATAGGTGATCCTAAAGTTGTTTTTATGGATGAGCCTAGCACTGGACTCGATCCAGCTTCAAGACATAATCTGCACGGGCAAAACAAGATTATAGCCACAGACAGTATAATAAGTTGGATTGATGGCACAGGATAG

Protein Analysis

162

Amino Acids

18.23

Weight (kDa)

9.12

Isoelectric Point (pI)

24.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 356, 398
AcsI RAATTY 2 cut(s) 8, 329
AcuI CTGAAG 1 cut(s) 102
AfaI GTAC 1 cut(s) 48
AfiI CCNNNNNNNGG 2 cut(s) 241, 395
AflII CTTAAG 1 cut(s) 287
AgsI TTSAA 3 cut(s) 77, 161, 414
AluBI AGCT 3 cut(s) 25, 104, 410
AluI AGCT 3 cut(s) 25, 104, 410
Alw26I GTCTC 2 cut(s) 133, 169
AlwI GGATC 2 cut(s) 356, 398
ApoI RAATTY 2 cut(s) 8, 329
Asp700I GAANNNNTTC 1 cut(s) 87
AsuHPI GGTGA 1 cut(s) 371
BbsI GAAGAC 1 cut(s) 289
BccI CCATC 2 cut(s) 209, 470
BcgI CGANNNNNNTGC 2 cut(s) 382, 416
BcoDI GTCTC 2 cut(s) 133, 169
BfaI CTAG 3 cut(s) 26, 105, 390
BfmI CTRYAG 1 cut(s) 99
BfrI CTTAAG 1 cut(s) 287
BmsI GCATC 1 cut(s) 274
BpiI GAAGAC 1 cut(s) 289
BpuEI CTTGAG 1 cut(s) 164
Bsc4I CCNNNNNNNGG 2 cut(s) 241, 395
Bse1I ACTGG 2 cut(s) 259, 400
BseGI GGATG 2 cut(s) 10, 388
BseLI CCNNNNNNNGG 2 cut(s) 241, 395
BseNI ACTGG 2 cut(s) 259, 400
BseRI GAGGAG 1 cut(s) 144
BsgI GTGCAG 2 cut(s) 191, 410
BslI CCNNNNNNNGG 2 cut(s) 241, 395
BsmAI GTCTC 2 cut(s) 133, 169
Bsp1407I TGTACA 1 cut(s) 46
Bsp143I GATC 3 cut(s) 208, 361, 403
BspPI GGATC 2 cut(s) 356, 398
BspTI CTTAAG 1 cut(s) 287
BsrGI TGTACA 1 cut(s) 46
BsrI ACTGG 2 cut(s) 259, 400
BssMI GATC 3 cut(s) 208, 361, 403
Bst4CI ACNGT 3 cut(s) 100, 232, 458
Bst6I CTCTTC 1 cut(s) 162
BstAFI CTTAAG 1 cut(s) 287
BstAUI TGTACA 1 cut(s) 46
BstC8I GCNNGC 1 cut(s) 23
BstF5I GGATG 2 cut(s) 10, 388
BstKTI GATC 3 cut(s) 211, 364, 406
BstMAI GTCTC 2 cut(s) 133, 169
BstMBI GATC 3 cut(s) 208, 361, 403
BstNSI RCATGY 1 cut(s) 21
BstSFI CTRYAG 1 cut(s) 99
BstV2I GAAGAC 1 cut(s) 289
BtsCI GGATG 2 cut(s) 10, 388
BtsI GCAGTG 1 cut(s) 327
BtsIMutI CAGTG 3 cut(s) 327, 350, 393
Cac8I GCNNGC 1 cut(s) 23
Csp6I GTAC 1 cut(s) 47
CviAII CATG 2 cut(s) 18, 44
CviJI RGCY 7 cut(s) 25, 104, 185, 206, 388, 410, 449
CviKI_1 RGCY 7 cut(s) 25, 104, 185, 206, 388, 410, 449
CviQI GTAC 1 cut(s) 47
DpnI GATC 3 cut(s) 210, 363, 405
DpnII GATC 3 cut(s) 208, 361, 403
Eam1104I CTCTTC 1 cut(s) 162
EarI CTCTTC 1 cut(s) 162
Eco57I CTGAAG 1 cut(s) 102
FaeI CATG 2 cut(s) 21, 47
FaiI YATR 8 cut(s) 19, 45, 241, 279, 380, 420, 446, 461
FatI CATG 2 cut(s) 17, 43
FokI GGATG 2 cut(s) 17, 395
FspBI CTAG 3 cut(s) 26, 105, 390
Hin1II CATG 2 cut(s) 21, 47
HinfI GANTC 4 cut(s) 31, 108, 177, 399
HphI GGTGA 1 cut(s) 371
Hpy188I TCNGA 2 cut(s) 36, 236
Hpy188III TCNNGA 3 cut(s) 212, 306, 414
HpyAV CCTTC 2 cut(s) 196, 252
HpyCH4III ACNGT 3 cut(s) 100, 232, 458
HpyCH4V TGCA 5 cut(s) 21, 149, 172, 344, 427
Hsp92II CATG 2 cut(s) 21, 47
Kzo9I GATC 3 cut(s) 208, 361, 403
LmnI GCTCC 1 cut(s) 262
LpnPI CCDG 5 cut(s) 240, 291, 381, 420, 468
LweI GCATC 1 cut(s) 274
MaeI CTAG 3 cut(s) 26, 105, 390
MalI GATC 3 cut(s) 210, 363, 405
MboI GATC 3 cut(s) 208, 361, 403
MboII GAAGA 4 cut(s) 95, 149, 294, 338
MluCI AATT 3 cut(s) 8, 329, 345
MlyI GAGTC 2 cut(s) 171, 393
MmeI TCCRAC 3 cut(s) 116, 259, 449
MnlI CCTC 2 cut(s) 165, 305
MroXI GAANNNNTTC 1 cut(s) 87
MseI TTAA 3 cut(s) 225, 288, 311
MspCI CTTAAG 1 cut(s) 287
NdeII GATC 3 cut(s) 208, 361, 403
NlaIII CATG 2 cut(s) 21, 47
NspI RCATGY 1 cut(s) 21
PdmI GAANNNNTTC 1 cut(s) 87
PfeI GAWTC 2 cut(s) 31, 108
PleI GAGTC 2 cut(s) 171, 393
PpsI GAGTC 2 cut(s) 171, 393
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SaqAI TTAA 3 cut(s) 225, 288, 311
Sau3AI GATC 3 cut(s) 208, 361, 403
SchI GAGTC 2 cut(s) 171, 393
SetI ASST 6 cut(s) 27, 106, 297, 304, 361, 412
SfaNI GCATC 1 cut(s) 274
SfcI CTRYAG 1 cut(s) 99
SmlI CTYRAG 2 cut(s) 179, 287
SmoI CTYRAG 2 cut(s) 179, 287
Sse9I AATT 3 cut(s) 8, 329, 345
SspMI CTAG 3 cut(s) 26, 105, 390
TaaI ACNGT 3 cut(s) 100, 232, 458
TaqI TCGA 1 cut(s) 402
TasI AATT 3 cut(s) 8, 329, 345
TatI WGTACW 1 cut(s) 46
TfiI GAWTC 2 cut(s) 31, 108
Tru1I TTAA 3 cut(s) 225, 288, 311
Tru9I TTAA 3 cut(s) 225, 288, 311
TscAI CASTG 3 cut(s) 327, 357, 400
TspDTI ATGAA 2 cut(s) 21, 215
TspRI CASTG 3 cut(s) 327, 357, 400
Vha464I CTTAAG 1 cut(s) 287
XapI RAATTY 2 cut(s) 8, 329
XceI RCATGY 1 cut(s) 21
XcmI CCANNNNNNNNNTGG 1 cut(s) 139
XmnI GAANNNNTTC 1 cut(s) 87
XspI CTAG 3 cut(s) 26, 105, 390
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.