Rh3AG279600

ABC transporter A family member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
32567091 .. 32590637
23547 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG279600.1

Sequence Viewer

Length: 207 bp
ATGAAGAACAAGTATCCAAACCTACTCTCTGAATCGCCTGGTACGCAACTTGACATCCAGACTTCTATGGAGAAAGTCAATAAGTTGCTACTAGAACCGGATACAAGTCATGCAATTATTTGCAAAAATCTCAAAAAGGTTTATCCTGGAAGAGACGAAAACCCTGAGAAATTTGCCGTGAGAGGGATGTCTCTTGCTTTGTCTTGA

Protein Analysis

68

Amino Acids

7.63

Weight (kDa)

8.82

Isoelectric Point (pI)

30.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 170
AfaI GTAC 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 183
AjnI CCWGG 2 cut(s) 37, 145
Alw26I GTCTC 2 cut(s) 147, 195
ApoI RAATTY 1 cut(s) 170
BceAI ACGGC 1 cut(s) 161
BciT130I CCWGG 2 cut(s) 39, 147
BciVI GTATCC 2 cut(s) 24, 94
BcoDI GTCTC 2 cut(s) 147, 195
BfaI CTAG 1 cut(s) 92
BfuI GTATCC 2 cut(s) 24, 94
Bme1390I CCNGG 2 cut(s) 39, 147
BmrFI CCNGG 2 cut(s) 39, 147
BsaWI WCCGGW 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 183
BseBI CCWGG 2 cut(s) 39, 147
BseGI GGATG 2 cut(s) 54, 192
BseLI CCNNNNNNNGG 1 cut(s) 183
BseMII CTCAG 1 cut(s) 156
BsiSI CCGG 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 183
BsmAI GTCTC 2 cut(s) 147, 195
BsmBI CGTCTC 1 cut(s) 147
BspCNI CTCAG 1 cut(s) 157
Bst2UI CCWGG 2 cut(s) 39, 147
Bst6I CTCTTC 1 cut(s) 145
BstDEI CTNAG 1 cut(s) 165
BstF5I GGATG 2 cut(s) 54, 192
BstMAI GTCTC 2 cut(s) 147, 195
BstMWI GCNNNNNNNGC 1 cut(s) 43
BstNI CCWGG 2 cut(s) 39, 147
BstSCI CCNGG 2 cut(s) 37, 145
BsuI GTATCC 2 cut(s) 24, 94
BtsCI GGATG 2 cut(s) 54, 192
Csp6I GTAC 1 cut(s) 42
CviAII CATG 1 cut(s) 110
CviQI GTAC 1 cut(s) 42
DdeI CTNAG 1 cut(s) 165
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
EcoRII CCWGG 2 cut(s) 37, 145
Esp3I CGTCTC 1 cut(s) 147
FaeI CATG 1 cut(s) 113
FaiI YATR 2 cut(s) 68, 111
FatI CATG 1 cut(s) 109
FokI GGATG 2 cut(s) 41, 199
FspBI CTAG 1 cut(s) 92
HapII CCGG 1 cut(s) 98
Hin1II CATG 1 cut(s) 113
HinfI GANTC 1 cut(s) 32
HpaII CCGG 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 31
Hpy188III TCNNGA 2 cut(s) 58, 204
HpyCH4V TGCA 2 cut(s) 113, 123
HpyF10VI GCNNNNNNNGC 1 cut(s) 43
HpyF3I CTNAG 1 cut(s) 165
Hsp92II CATG 1 cut(s) 113
LpnPI CCDG 7 cut(s) 24, 51, 71, 111, 132, 159, 177
MaeI CTAG 1 cut(s) 92
MboII GAAGA 2 cut(s) 16, 162
MluCI AATT 2 cut(s) 114, 170
MnlI CCTC 1 cut(s) 176
MspI CCGG 1 cut(s) 98
MspR9I CCNGG 2 cut(s) 39, 147
MvaI CCWGG 2 cut(s) 39, 147
MwoI GCNNNNNNNGC 1 cut(s) 43
NlaIII CATG 1 cut(s) 113
PfeI GAWTC 1 cut(s) 32
PfoI TCCNGGA 1 cut(s) 145
Psp6I CCWGG 2 cut(s) 37, 145
PspGI CCWGG 2 cut(s) 37, 145
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
ScrFI CCNGG 2 cut(s) 39, 147
SetI ASST 2 cut(s) 24, 141
Sse9I AATT 2 cut(s) 114, 170
SspMI CTAG 1 cut(s) 92
StyD4I CCNGG 2 cut(s) 37, 145
TasI AATT 2 cut(s) 114, 170
TfiI GAWTC 1 cut(s) 32
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 170
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.