RchiOBHm_Chr3g0487131

ABC transporter A family member

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
34301023 .. 34306164
5142 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45157

Sequence Viewer

Length: 171 bp
ATGCTTGGCCATAATTTTGCTGGGAAGACTTCTTTTATTAATATGATGATTGGTCTGACAAAGTCAACCTTTGGCACAGCTTTTGTTCAAGGTCTGGACATCAACACTCGGATGAAATATATACTAGCATGGGAGTCTGTCCATAGCATGACCTACTATGGGAAACCCTGA

Protein Analysis

56

Amino Acids

6.31

Weight (kDa)

9.6

Isoelectric Point (pI)

12.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 7
AfiI CCNNNNNNNGG 1 cut(s) 159
AgsI TTSAA 1 cut(s) 89
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
AoxI GGCC 1 cut(s) 7
AseI ATTAAT 1 cut(s) 39
BalI TGGCCA 1 cut(s) 9
BbsI GAAGAC 1 cut(s) 32
BfaI CTAG 1 cut(s) 125
BpiI GAAGAC 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 159
BseGI GGATG 1 cut(s) 117
BseLI CCNNNNNNNGG 1 cut(s) 159
BseYI CCCAGC 1 cut(s) 20
BshFI GGCC 1 cut(s) 9
BslI CCNNNNNNNGG 1 cut(s) 159
BsnI GGCC 1 cut(s) 9
BspANI GGCC 1 cut(s) 9
BstF5I GGATG 1 cut(s) 117
BstV2I GAAGAC 1 cut(s) 32
BsuRI GGCC 1 cut(s) 9
BtsCI GGATG 1 cut(s) 117
CviAII CATG 2 cut(s) 129, 148
CviJI RGCY 2 cut(s) 9, 80
CviKI_1 RGCY 2 cut(s) 9, 80
EaeI YGGCCR 1 cut(s) 7
FaeI CATG 2 cut(s) 132, 151
FaiI YATR 8 cut(s) 12, 44, 120, 122, 130, 144, 149, 159
FalI AAGNNNNNCTT 2 cut(s) 53, 85
FatI CATG 2 cut(s) 128, 147
FokI GGATG 1 cut(s) 124
FspBI CTAG 1 cut(s) 125
GsaI CCCAGC 1 cut(s) 24
HaeIII GGCC 1 cut(s) 9
Hin1II CATG 2 cut(s) 132, 151
HincII GTYRAC 1 cut(s) 66
HindII GTYRAC 1 cut(s) 66
HinfI GANTC 1 cut(s) 134
Hpy166II GTNNAC 1 cut(s) 66
Hpy188I TCNGA 2 cut(s) 57, 111
Hpy188III TCNNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 66
Hsp92II CATG 2 cut(s) 132, 151
LpnPI CCDG 2 cut(s) 6, 80
MaeI CTAG 1 cut(s) 125
MboII GAAGA 1 cut(s) 37
MlsI TGGCCA 1 cut(s) 9
MluCI AATT 1 cut(s) 13
MluNI TGGCCA 1 cut(s) 9
MlyI GAGTC 1 cut(s) 143
Mox20I TGGCCA 1 cut(s) 9
MscI TGGCCA 1 cut(s) 9
MseI TTAA 1 cut(s) 39
MslI CAYNNNNRTG 1 cut(s) 110
Msp20I TGGCCA 1 cut(s) 9
NlaIII CATG 2 cut(s) 132, 151
PflFI GACNNNGTC 1 cut(s) 61
PleI GAGTC 1 cut(s) 142
PpsI GAGTC 1 cut(s) 142
PshBI ATTAAT 1 cut(s) 39
PspFI CCCAGC 1 cut(s) 20
PsyI GACNNNGTC 1 cut(s) 61
RseI CAYNNNNRTG 1 cut(s) 110
SaqAI TTAA 1 cut(s) 39
SchI GAGTC 1 cut(s) 143
SetI ASST 4 cut(s) 71, 82, 94, 155
SgeI CNNG 8 cut(s) 17, 33, 101, 107, 120, 137, 141, 160
SmiMI CAYNNNNRTG 1 cut(s) 110
Sse9I AATT 1 cut(s) 13
SspMI CTAG 1 cut(s) 125
TasI AATT 1 cut(s) 13
Tru1I TTAA 1 cut(s) 39
Tru9I TTAA 1 cut(s) 39
TspDTI ATGAA 1 cut(s) 128
Tth111I GACNNNGTC 1 cut(s) 61
VspI ATTAAT 1 cut(s) 39
XcmI CCANNNNNNNNNTGG 1 cut(s) 17
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.