Rh5BG416000

ABC transporter A family member

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
67475893 .. 67479503
3611 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG416000.1

Sequence Viewer

Length: 201 bp
ATGTCTTGGTATGGAACAATAAAAGACATTGTTGAGTTGCGGTATAGAAAGAGGAATAGGATGGAGAAATTCAACAAGTTGCTACTAGAACCGGATACAAGTCATGCAATTATTTGCAACAATCTCAAAAAGGTTTATCCTGGAAGAGATGGAAACCTTGAGAAATTGGTCGTGAGAGGGATGTCTCTTGCTTTGTCTTGA

Protein Analysis

66

Amino Acids

7.72

Weight (kDa)

9.84

Isoelectric Point (pI)

20.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 40
AcsI RAATTY 1 cut(s) 68
AgsI TTSAA 1 cut(s) 73
AjnI CCWGG 1 cut(s) 139
Alw26I GTCTC 1 cut(s) 189
ApoI RAATTY 1 cut(s) 68
BccI CCATC 2 cut(s) 55, 143
BciT130I CCWGG 1 cut(s) 141
BciVI GTATCC 1 cut(s) 88
BcoDI GTCTC 1 cut(s) 189
BfaI CTAG 1 cut(s) 86
BfuI GTATCC 1 cut(s) 88
Bme1390I CCNGG 1 cut(s) 141
BmrFI CCNGG 1 cut(s) 141
BpuEI CTTGAG 1 cut(s) 179
BsaWI WCCGGW 1 cut(s) 91
BseBI CCWGG 1 cut(s) 141
BseGI GGATG 2 cut(s) 66, 186
BsiSI CCGG 1 cut(s) 92
BsmAI GTCTC 1 cut(s) 189
BspACI CCGC 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 141
Bst6I CTCTTC 1 cut(s) 139
BstF5I GGATG 2 cut(s) 66, 186
BstMAI GTCTC 1 cut(s) 189
BstNI CCWGG 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 139
BsuI GTATCC 1 cut(s) 88
BtsCI GGATG 2 cut(s) 66, 186
CviAII CATG 1 cut(s) 104
Eam1104I CTCTTC 1 cut(s) 139
EarI CTCTTC 1 cut(s) 139
EcoRII CCWGG 1 cut(s) 139
FaeI CATG 1 cut(s) 107
FaiI YATR 3 cut(s) 12, 45, 105
FatI CATG 1 cut(s) 103
FokI GGATG 2 cut(s) 73, 193
FspBI CTAG 1 cut(s) 86
HapII CCGG 1 cut(s) 92
Hin1II CATG 1 cut(s) 107
HpaII CCGG 1 cut(s) 92
Hpy188III TCNNGA 2 cut(s) 172, 198
HpyCH4V TGCA 2 cut(s) 107, 117
Hsp92II CATG 1 cut(s) 107
LpnPI CCDG 3 cut(s) 105, 126, 153
MaeI CTAG 1 cut(s) 86
MboII GAAGA 1 cut(s) 156
MluCI AATT 3 cut(s) 68, 108, 164
MnlI CCTC 2 cut(s) 45, 170
MspI CCGG 1 cut(s) 92
MspR9I CCNGG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 141
NlaIII CATG 1 cut(s) 107
PfoI TCCNGGA 1 cut(s) 139
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
ScrFI CCNGG 1 cut(s) 141
SetI ASST 2 cut(s) 135, 159
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
Sse9I AATT 3 cut(s) 68, 108, 164
SsiI CCGC 1 cut(s) 40
SspMI CTAG 1 cut(s) 86
StyD4I CCNGG 1 cut(s) 139
TasI AATT 3 cut(s) 68, 108, 164
XapI RAATTY 1 cut(s) 68
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.