RchiOBHm_Chr5g0061621

ABC transporter A family member

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
67179977 .. 67182275
2299 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33797

Sequence Viewer

Length: 372 bp
ATGAATTGGTTTAGCAAAGCTGACTGTCTTACAGGATTAAAATTCTTCACACTGAATGACTACAGCATCCAATTTGTCTTTTACTTCATCTATATCAACAACTTTTCTAGTATCTACTACGTTTTCAAATGTGAAGACTTCTACAGCCTACTATGGGAAACCCTGACTAAAATGGAGCATCTGCTTTATTATGGAAGACTTAAGAACCTCAAAGGTTCTGGAATAAGAAAAATAGTGGAAGAATTTTGTTTCTTTGCAATTTCACTGATAGGTGATCCTAAAGTTGTTTTTATGGATGAGCCTAGCACTGGACTCGATCCAGCTTCAAGACATAATCTATACGGGCAAAACAAGATTGTGCAATCATCCTAA

Protein Analysis

123

Amino Acids

14.47

Weight (kDa)

6.71

Isoelectric Point (pI)

30.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 269, 311
AcsI RAATTY 2 cut(s) 41, 242
AfiI CCNNNNNNNGG 2 cut(s) 154, 308
AflII CTTAAG 1 cut(s) 200
AgsI TTSAA 2 cut(s) 127, 327
AluBI AGCT 2 cut(s) 20, 323
AluI AGCT 2 cut(s) 20, 323
AlwI GGATC 2 cut(s) 269, 311
ApoI RAATTY 2 cut(s) 41, 242
AsuHPI GGTGA 1 cut(s) 284
BbsI GAAGAC 2 cut(s) 141, 202
BcgI CGANNNNNNTGC 2 cut(s) 295, 329
BfaI CTAG 2 cut(s) 108, 303
BfmI CTRYAG 2 cut(s) 61, 142
BfrI CTTAAG 1 cut(s) 200
BmsI GCATC 2 cut(s) 75, 187
BpiI GAAGAC 2 cut(s) 141, 202
Bsc4I CCNNNNNNNGG 2 cut(s) 154, 308
Bse1I ACTGG 1 cut(s) 313
BseGI GGATG 3 cut(s) 66, 301, 365
BseLI CCNNNNNNNGG 2 cut(s) 154, 308
BseNI ACTGG 1 cut(s) 313
BslI CCNNNNNNNGG 2 cut(s) 154, 308
Bsp143I GATC 2 cut(s) 274, 316
BspPI GGATC 2 cut(s) 269, 311
BspTI CTTAAG 1 cut(s) 200
BsrI ACTGG 1 cut(s) 313
BssMI GATC 2 cut(s) 274, 316
Bst4CI ACNGT 1 cut(s) 26
BstAFI CTTAAG 1 cut(s) 200
BstF5I GGATG 3 cut(s) 66, 301, 365
BstKTI GATC 2 cut(s) 277, 319
BstMBI GATC 2 cut(s) 274, 316
BstSFI CTRYAG 2 cut(s) 61, 142
BstV2I GAAGAC 2 cut(s) 141, 202
BtsCI GGATG 3 cut(s) 66, 301, 365
BtsIMutI CAGTG 3 cut(s) 50, 263, 306
CviJI RGCY 4 cut(s) 20, 147, 301, 323
CviKI_1 RGCY 4 cut(s) 20, 147, 301, 323
DpnI GATC 2 cut(s) 276, 318
DpnII GATC 2 cut(s) 274, 316
FaiI YATR 6 cut(s) 93, 154, 192, 293, 333, 340
FokI GGATG 3 cut(s) 53, 308, 352
FspBI CTAG 2 cut(s) 108, 303
HinfI GANTC 1 cut(s) 312
HphI GGTGA 1 cut(s) 284
Hpy188III TCNNGA 2 cut(s) 219, 327
HpyCH4III ACNGT 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 120
HpyCH4V TGCA 2 cut(s) 257, 361
HpySE526I ACGT 1 cut(s) 120
Kzo9I GATC 2 cut(s) 274, 316
LmnI GCTCC 1 cut(s) 175
LpnPI CCDG 5 cut(s) 18, 176, 204, 294, 333
LweI GCATC 2 cut(s) 75, 187
MaeI CTAG 2 cut(s) 108, 303
MaeII ACGT 1 cut(s) 120
MalI GATC 2 cut(s) 276, 318
MboI GATC 2 cut(s) 274, 316
MboII GAAGA 4 cut(s) 37, 146, 207, 251
MluCI AATT 5 cut(s) 4, 41, 71, 242, 258
MlyI GAGTC 1 cut(s) 306
MnlI CCTC 1 cut(s) 218
MseI TTAA 2 cut(s) 38, 201
MspCI CTTAAG 1 cut(s) 200
NdeII GATC 2 cut(s) 274, 316
PleI GAGTC 1 cut(s) 306
PpsI GAGTC 1 cut(s) 306
SaqAI TTAA 2 cut(s) 38, 201
Sau3AI GATC 2 cut(s) 274, 316
SchI GAGTC 1 cut(s) 306
SetI ASST 6 cut(s) 22, 123, 210, 217, 274, 325
SfaNI GCATC 2 cut(s) 75, 187
SfcI CTRYAG 2 cut(s) 61, 142
SmlI CTYRAG 1 cut(s) 200
SmoI CTYRAG 1 cut(s) 200
Sse9I AATT 5 cut(s) 4, 41, 71, 242, 258
SspMI CTAG 2 cut(s) 108, 303
TaaI ACNGT 1 cut(s) 26
TaiI ACGT 1 cut(s) 123
TaqI TCGA 1 cut(s) 315
TasI AATT 5 cut(s) 4, 41, 71, 242, 258
Tru1I TTAA 2 cut(s) 38, 201
Tru9I TTAA 2 cut(s) 38, 201
TscAI CASTG 3 cut(s) 57, 270, 313
TspDTI ATGAA 2 cut(s) 17, 76
TspRI CASTG 3 cut(s) 57, 270, 313
Vha464I CTTAAG 1 cut(s) 200
XapI RAATTY 2 cut(s) 41, 242
XspI CTAG 2 cut(s) 108, 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.