pycom14g11860

Domain of unknown function (DUF4042)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
14925073 .. 14925384
312 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g11860.2

Sequence Viewer

Length: 186 bp
ATGAAGCAGAGTGAAGCTTGGGGTTCTCAAAGTTTATCAGATCATGAATCTTCCGCGAATGAGTTTGCATTGTCAGATTCAGATTACAGTGACAGTGATGGATCATACCTGATTAAAGACACTGACAACATTCAGAAATCAAAAGTCCGAGTAGCTGCCATTGTTTGTATACAGGCTACAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.66

Weight (kDa)

4.39

Isoelectric Point (pI)

49.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 169
AccII CGCG 1 cut(s) 56
AciI CCGC 1 cut(s) 54
AclWI GGATC 1 cut(s) 109
AluBI AGCT 2 cut(s) 17, 155
AluI AGCT 2 cut(s) 17, 155
AlwI GGATC 1 cut(s) 109
ApeKI GCWGC 1 cut(s) 155
BbvI GCAGC 1 cut(s) 142
BccI CCATC 1 cut(s) 92
BfmI CTRYAG 1 cut(s) 177
BisI GCNGC 1 cut(s) 156
BlsI GCNGC 1 cut(s) 157
BseXI GCAGC 1 cut(s) 142
Bsh1236I CGCG 1 cut(s) 56
Bsp143I GATC 2 cut(s) 40, 101
BspACI CCGC 1 cut(s) 54
BspFNI CGCG 1 cut(s) 56
BspHI TCATGA 1 cut(s) 43
BspPI GGATC 1 cut(s) 109
BssMI GATC 2 cut(s) 40, 101
BssNAI GTATAC 1 cut(s) 170
Bst1107I GTATAC 1 cut(s) 170
Bst4CI ACNGT 2 cut(s) 89, 95
BstFNI CGCG 1 cut(s) 56
BstKTI GATC 2 cut(s) 43, 104
BstMBI GATC 2 cut(s) 40, 101
BstSFI CTRYAG 1 cut(s) 177
BstUI CGCG 1 cut(s) 56
BstV1I GCAGC 1 cut(s) 142
BstZ17I GTATAC 1 cut(s) 170
BtsIMutI CAGTG 3 cut(s) 94, 100, 120
CciI TCATGA 1 cut(s) 43
CviAII CATG 1 cut(s) 44
CviJI RGCY 3 cut(s) 17, 155, 176
CviKI_1 RGCY 3 cut(s) 17, 155, 176
DpnI GATC 2 cut(s) 42, 103
DpnII GATC 2 cut(s) 40, 101
FaeI CATG 1 cut(s) 47
FaiI YATR 3 cut(s) 45, 106, 170
FatI CATG 1 cut(s) 43
FblI GTMKAC 1 cut(s) 169
Fnu4HI GCNGC 1 cut(s) 156
Fsp4HI GCNGC 1 cut(s) 156
FspEI CC 9 cut(s) 4, 5, 6, 67, 84, 122, 158, 161, 172
GluI GCNGC 1 cut(s) 156
Hin1II CATG 1 cut(s) 47
HindIII AAGCTT 1 cut(s) 15
HinfI GANTC 2 cut(s) 47, 77
Hpy166II GTNNAC 1 cut(s) 170
Hpy188I TCNGA 5 cut(s) 40, 76, 82, 135, 149
Hpy188III TCNNGA 1 cut(s) 44
Hpy8I GTNNAC 1 cut(s) 170
HpyCH4III ACNGT 2 cut(s) 89, 95
HpyCH4V TGCA 1 cut(s) 68
Hsp92II CATG 1 cut(s) 47
Kzo9I GATC 2 cut(s) 40, 101
LpnPI CCDG 2 cut(s) 122, 158
Lsp1109I GCAGC 1 cut(s) 142
MaeIII GTNAC 1 cut(s) 89
MalI GATC 2 cut(s) 42, 103
MboI GATC 2 cut(s) 40, 101
MboII GAAGA 1 cut(s) 42
MseI TTAA 1 cut(s) 114
MvnI CGCG 1 cut(s) 56
NdeII GATC 2 cut(s) 40, 101
NlaIII CATG 1 cut(s) 47
NmuCI GTSAC 1 cut(s) 89
PagI TCATGA 1 cut(s) 43
PfeI GAWTC 2 cut(s) 47, 77
PkrI GCNGC 1 cut(s) 157
SaqAI TTAA 1 cut(s) 114
SatI GCNGC 1 cut(s) 156
Sau3AI GATC 2 cut(s) 40, 101
SetI ASST 3 cut(s) 19, 111, 157
SfcI CTRYAG 1 cut(s) 177
SgeI CNNG 5 cut(s) 30, 56, 67, 121, 161
SsiI CCGC 1 cut(s) 54
TaaI ACNGT 2 cut(s) 89, 95
TfiI GAWTC 2 cut(s) 47, 77
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TscAI CASTG 3 cut(s) 94, 100, 127
TseFI GTSAC 1 cut(s) 89
TseI GCWGC 1 cut(s) 155
Tsp45I GTSAC 1 cut(s) 89
TspDTI ATGAA 2 cut(s) 17, 60
TspRI CASTG 3 cut(s) 94, 100, 127
XmiI GTMKAC 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.