RchiOBHm_Chr7g0188111

HEAT repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
7744961 .. 7746259
1299 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16796

Sequence Viewer

Length: 165 bp
ATGAATCTGGAGTACTGCTTGTTTCAACTCGTTTTCCATAACTTTTCATCCTTACATATTATTACCATGACGCTTGTGCTTTACAGGTTTTATTTATCTCTCCTGCATAGTCTGCACTTGACTCTCTCAGATCTTAAGTGTTCCCTCCCTGACCATGTTTTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.39

Weight (kDa)

6.47

Isoelectric Point (pI)

29.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 14
AflII CTTAAG 1 cut(s) 134
AgsI TTSAA 1 cut(s) 26
BfrI CTTAAG 1 cut(s) 134
BglII AGATCT 1 cut(s) 130
BmcAI AGTACT 1 cut(s) 14
BpmI CTGGAG 1 cut(s) 29
BseGI GGATG 1 cut(s) 47
BseMII CTCAG 1 cut(s) 141
BsgI GTGCAG 1 cut(s) 98
Bsp143I GATC 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 140
BspTI CTTAAG 1 cut(s) 134
BssMI GATC 1 cut(s) 130
BstAFI CTTAAG 1 cut(s) 134
BstAPI GCANNNNNTGC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 127
BstF5I GGATG 1 cut(s) 47
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstMWI GCNNNNNNNGC 1 cut(s) 112
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
BtsCI GGATG 1 cut(s) 47
CseI GACGC 1 cut(s) 79
Csp6I GTAC 1 cut(s) 13
CviAII CATG 2 cut(s) 67, 155
CviQI GTAC 1 cut(s) 13
DdeI CTNAG 1 cut(s) 127
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
FaeI CATG 2 cut(s) 70, 158
FaiI YATR 5 cut(s) 39, 57, 68, 108, 156
FatI CATG 2 cut(s) 66, 154
FokI GGATG 1 cut(s) 34
FspEI CC 8 cut(s) 50, 64, 70, 79, 116, 157, 158, 161
GsuI CTGGAG 1 cut(s) 29
HgaI GACGC 1 cut(s) 79
Hin1II CATG 2 cut(s) 70, 158
HinfI GANTC 2 cut(s) 4, 121
Hpy188I TCNGA 1 cut(s) 130
Hpy188III TCNNGA 1 cut(s) 8
HpyCH4V TGCA 2 cut(s) 106, 115
HpyF10VI GCNNNNNNNGC 1 cut(s) 112
HpyF3I CTNAG 1 cut(s) 127
Hsp92II CATG 2 cut(s) 70, 158
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 2 cut(s) 70, 116
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MflI RGATCY 1 cut(s) 130
MlyI GAGTC 1 cut(s) 115
MnlI CCTC 1 cut(s) 155
MseI TTAA 1 cut(s) 135
MspCI CTTAAG 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 112
NdeII GATC 1 cut(s) 130
NlaIII CATG 2 cut(s) 70, 158
PfeI GAWTC 1 cut(s) 4
PleI GAGTC 1 cut(s) 115
PpsI GAGTC 1 cut(s) 115
PsuI RGATCY 1 cut(s) 130
RsaI GTAC 1 cut(s) 14
RsaNI GTAC 1 cut(s) 13
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 1 cut(s) 130
ScaI AGTACT 1 cut(s) 14
SchI GAGTC 1 cut(s) 115
SetI ASST 1 cut(s) 89
SgeI CNNG 9 cut(s) 20, 31, 41, 79, 86, 97, 115, 130, 161
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
TatI WGTACW 1 cut(s) 12
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TspDTI ATGAA 2 cut(s) 17, 36
Vha464I CTTAAG 1 cut(s) 134
ZrmI AGTACT 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.