pycom16g06330

60S ribosomal protein L34-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0001880
Physical Location & Seq
Forward (+)
4069769 .. 4070928
1160 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 366 bp
ATGGTGCAGCGTCTCACGTATCGCGCCCGGCACAGCTACGCCACCAAATCCAACCAGCACAGGATCGTCAAAACCCCTGGAGGGAAGCTAGTGTACCAGACCACTAAGAAGAGGGCCAGTGGGCCCAAGTGCCCTGTTACCGGCAAGAGAATTCAAGGGATCCCTCACTTGAGGCCTACTGAGTATAAGAGGTCCAGATTATCTAGGAATCGCAGGACTGTTAACCGTGCTTATGGAGGTGTGTTGTCTGGAGGTGCCGTCAAGGAAAGGATCATCAGGGCCTTTCTGGTGGAGGAACAAAAGATCGTGAAAAAGGTGTTGAAGATTCAAAAGACGAAGGAAAAGCAAGCTGCAAAGACCAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L34e

Protein Analysis

122

Amino Acids

13.84

Weight (kDa)

11.51

Isoelectric Point (pI)

37.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L34e PF01199 1 - 96 4.3e-38 Ribosomal protein L34e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 254
AccII CGCG 1 cut(s) 24
AclWI GGATC 4 cut(s) 71, 154, 167, 278
AcsI RAATTY 1 cut(s) 150
AfaI GTAC 1 cut(s) 95
AfiI CCNNNNNNNGG 2 cut(s) 81, 140
AgsI TTSAA 3 cut(s) 155, 322, 329
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 3 cut(s) 36, 88, 350
AluI AGCT 3 cut(s) 36, 88, 350
Alw26I GTCTC 1 cut(s) 17
AlwI GGATC 4 cut(s) 71, 154, 167, 278
AoxI GGCC 4 cut(s) 114, 122, 173, 279
ApaI GGGCCC 1 cut(s) 126
ApeKI GCWGC 2 cut(s) 7, 350
ApoI RAATTY 1 cut(s) 150
AspLEI GCGC 1 cut(s) 26
AspS9I GGNCC 5 cut(s) 114, 122, 123, 192, 279
AsuC2I CCSGG 1 cut(s) 28
AvaII GGWCC 1 cut(s) 192
BaeGI GKGCMC 2 cut(s) 126, 134
BamHI GGATCC 1 cut(s) 159
BanI GGYRCC 1 cut(s) 254
BanII GRGCYC 1 cut(s) 126
BarI GAAGNNNNNNTAC 2 cut(s) 77, 109
BbvI GCAGC 2 cut(s) 19, 337
BceAI ACGGC 1 cut(s) 242
BciT130I CCWGG 1 cut(s) 78
BcnI CCSGG 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 17
BfaI CTAG 2 cut(s) 89, 204
BisI GCNGC 2 cut(s) 8, 351
BlsI GCNGC 2 cut(s) 9, 352
Bme1390I CCNGG 2 cut(s) 28, 78
Bme18I GGWCC 1 cut(s) 192
BmgT120I GGNCC 5 cut(s) 114, 122, 123, 192, 279
BmiI GGNNCC 3 cut(s) 124, 161, 256
BmrFI CCNGG 2 cut(s) 28, 78
BpmI CTGGAG 2 cut(s) 99, 270
BpuEI CTTGAG 1 cut(s) 190
BpuMI CCSGG 1 cut(s) 28
BsaAI YACGTR 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 76
BsaXI ACNNNNNCTCC 2 cut(s) 243, 273
Bsc4I CCNNNNNNNGG 2 cut(s) 81, 140
Bse118I RCCGGY 1 cut(s) 140
Bse1I ACTGG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 76
BseLI CCNNNNNNNGG 2 cut(s) 81, 140
BseMII CTCAG 1 cut(s) 171
BseNI ACTGG 1 cut(s) 117
BseSI GKGCMC 2 cut(s) 126, 134
BseXI GCAGC 2 cut(s) 19, 337
BsgI GTGCAG 1 cut(s) 26
Bsh1236I CGCG 1 cut(s) 24
BshFI GGCC 4 cut(s) 116, 124, 175, 281
BshNI GGYRCC 1 cut(s) 254
BsiSI CCGG 2 cut(s) 28, 141
BslI CCNNNNNNNGG 2 cut(s) 81, 140
BsmAI GTCTC 1 cut(s) 17
BsmBI CGTCTC 1 cut(s) 17
BsnI GGCC 4 cut(s) 116, 124, 175, 281
Bsp120I GGGCCC 1 cut(s) 122
Bsp1286I GDGCHC 2 cut(s) 126, 134
Bsp143I GATC 4 cut(s) 63, 159, 270, 303
BspANI GGCC 4 cut(s) 116, 124, 175, 281
BspCNI CTCAG 1 cut(s) 172
BspFNI CGCG 1 cut(s) 24
BspLI GGNNCC 3 cut(s) 124, 161, 256
BspPI GGATC 4 cut(s) 71, 154, 167, 278
BspT107I GGYRCC 1 cut(s) 254
BsrFI RCCGGY 1 cut(s) 140
BsrI ACTGG 1 cut(s) 117
BssAI RCCGGY 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 76
BssMI GATC 4 cut(s) 63, 159, 270, 303
Bst2UI CCWGG 1 cut(s) 78
Bst4CI ACNGT 2 cut(s) 220, 227
Bst6I CTCTTC 1 cut(s) 104
BstBAI YACGTR 1 cut(s) 18
BstC8I GCNNGC 1 cut(s) 348
BstDEI CTNAG 2 cut(s) 105, 180
BstFNI CGCG 1 cut(s) 24
BstHHI GCGC 1 cut(s) 26
BstKTI GATC 4 cut(s) 66, 162, 273, 306
BstMAI GTCTC 1 cut(s) 17
BstMBI GATC 4 cut(s) 63, 159, 270, 303
BstNI CCWGG 1 cut(s) 78
BstSCI CCNGG 2 cut(s) 26, 76
BstSLI GKGCMC 2 cut(s) 126, 134
BstUI CGCG 1 cut(s) 24
BstV1I GCAGC 2 cut(s) 19, 337
BstX2I RGATCY 1 cut(s) 159
BstYI RGATCY 1 cut(s) 159
BsuRI GGCC 4 cut(s) 116, 124, 175, 281
BtsIMutI CAGTG 1 cut(s) 124
Cac8I GCNNGC 1 cut(s) 348
CfoI GCGC 1 cut(s) 26
Cfr10I RCCGGY 1 cut(s) 140
Cfr13I GGNCC 5 cut(s) 114, 122, 123, 192, 279
Csp6I GTAC 1 cut(s) 94
CviJI RGCY 7 cut(s) 36, 88, 116, 124, 175, 281, 350
CviKI_1 RGCY 7 cut(s) 36, 88, 116, 124, 175, 281, 350
CviQI GTAC 1 cut(s) 94
DdeI CTNAG 2 cut(s) 105, 180
DpnI GATC 4 cut(s) 65, 161, 272, 305
DpnII GATC 4 cut(s) 63, 159, 270, 303
Eam1104I CTCTTC 1 cut(s) 104
EarI CTCTTC 1 cut(s) 104
Eco147I AGGCCT 1 cut(s) 175
Eco24I GRGCYC 1 cut(s) 126
Eco47I GGWCC 1 cut(s) 192
EcoO109I RGGNCCY 1 cut(s) 279
EcoRI GAATTC 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 76
EcoT38I GRGCYC 1 cut(s) 126
Esp3I CGTCTC 1 cut(s) 17
FaiI YATR 2 cut(s) 186, 234
Fnu4HI GCNGC 2 cut(s) 8, 351
FriOI GRGCYC 1 cut(s) 126
Fsp4HI GCNGC 2 cut(s) 8, 351
FspBI CTAG 2 cut(s) 89, 204
GlaI GCGC 1 cut(s) 25
GluI GCNGC 2 cut(s) 8, 351
GsuI CTGGAG 2 cut(s) 99, 270
HaeIII GGCC 4 cut(s) 116, 124, 175, 281
HapII CCGG 2 cut(s) 28, 141
HhaI GCGC 1 cut(s) 26
Hin6I GCGC 1 cut(s) 24
HinP1I GCGC 1 cut(s) 24
HincII GTYRAC 1 cut(s) 223
HindII GTYRAC 1 cut(s) 223
HinfI GANTC 2 cut(s) 208, 325
HpaI GTTAAC 1 cut(s) 223
HpaII CCGG 2 cut(s) 28, 141
Hpy166II GTNNAC 2 cut(s) 94, 223
Hpy188III TCNNGA 3 cut(s) 195, 249, 307
Hpy8I GTNNAC 2 cut(s) 94, 223
HpyAV CCTTC 1 cut(s) 331
HpyCH4III ACNGT 2 cut(s) 220, 227
HpyCH4IV ACGT 1 cut(s) 17
HpyCH4V TGCA 2 cut(s) 7, 353
HpyF3I CTNAG 2 cut(s) 105, 180
HpySE526I ACGT 1 cut(s) 17
HspAI GCGC 1 cut(s) 24
KspAI GTTAAC 1 cut(s) 223
Kzo9I GATC 4 cut(s) 63, 159, 270, 303
Lsp1109I GCAGC 2 cut(s) 19, 337
MaeI CTAG 2 cut(s) 89, 204
MaeII ACGT 1 cut(s) 17
MaeIII GTNAC 1 cut(s) 136
MalI GATC 4 cut(s) 65, 161, 272, 305
MboI GATC 4 cut(s) 63, 159, 270, 303
MboII GAAGA 2 cut(s) 121, 334
MflI RGATCY 1 cut(s) 159
MhlI GDGCHC 2 cut(s) 126, 134
MluCI AATT 1 cut(s) 150
MmeI TCCRAC 1 cut(s) 75
MnlI CCTC 8 cut(s) 74, 105, 165, 174, 183, 230, 245, 286
MseI TTAA 1 cut(s) 222
MspI CCGG 2 cut(s) 28, 141
MspR9I CCNGG 2 cut(s) 28, 78
MvaI CCWGG 1 cut(s) 78
MvnI CGCG 1 cut(s) 24
NciI CCSGG 1 cut(s) 28
NdeII GATC 4 cut(s) 63, 159, 270, 303
NlaIV GGNNCC 3 cut(s) 124, 161, 256
PceI AGGCCT 1 cut(s) 175
PfeI GAWTC 2 cut(s) 208, 325
PkrI GCNGC 2 cut(s) 9, 352
Ppu21I YACGTR 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
PspN4I GGNNCC 3 cut(s) 124, 161, 256
PspOMI GGGCCC 1 cut(s) 122
PspPI GGNCC 5 cut(s) 114, 122, 123, 192, 279
PsuI RGATCY 1 cut(s) 159
RsaI GTAC 1 cut(s) 95
RsaNI GTAC 1 cut(s) 94
SaqAI TTAA 1 cut(s) 222
SatI GCNGC 2 cut(s) 8, 351
Sau3AI GATC 4 cut(s) 63, 159, 270, 303
Sau96I GGNCC 5 cut(s) 114, 122, 123, 192, 279
ScrFI CCNGG 2 cut(s) 28, 78
SduI GDGCHC 2 cut(s) 126, 134
SetI ASST 8 cut(s) 20, 38, 90, 194, 241, 256, 318, 352
SinI GGWCC 1 cut(s) 192
SmlI CTYRAG 1 cut(s) 169
SmoI CTYRAG 1 cut(s) 169
Sse9I AATT 1 cut(s) 150
SseBI AGGCCT 1 cut(s) 175
SspMI CTAG 2 cut(s) 89, 204
StuI AGGCCT 1 cut(s) 175
StyD4I CCNGG 2 cut(s) 26, 76
TaaI ACNGT 2 cut(s) 220, 227
TaiI ACGT 1 cut(s) 20
TasI AATT 1 cut(s) 150
TfiI GAWTC 2 cut(s) 208, 325
Tru1I TTAA 1 cut(s) 222
Tru9I TTAA 1 cut(s) 222
TscAI CASTG 1 cut(s) 124
TseI GCWGC 2 cut(s) 7, 350
TspRI CASTG 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 192
XapI RAATTY 1 cut(s) 150
XspI CTAG 2 cut(s) 89, 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.