RchiOBHm_Chr5g0017921

26S proteasome non-ATPase regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
12453536 .. 12455788
2253 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 195 bp
ATGTCCACTCGAAATTTTAAGAAGGCAGCCGATTTGTTCCTGGATTCCATTTCTACCTTCACCACTTACACAATATTTCCCTATGACATCTTAATATTTTATACCGTCCTGACAAGCATTATATCTTTGGACAGAGTTTCTTTAAAACAGAAGCTTGATTCTTTGGAGCGTATATATGCTTTCCATTTGCTGTAG

Protein Analysis

64

Amino Acids

7.5

Weight (kDa)

8.05

Isoelectric Point (pI)

36.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RPN7 PF10602 1 - 51 3e-15 26S proteasome subunit RPN7
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 13
AjnI CCWGG 1 cut(s) 39
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
ApeKI GCWGC 1 cut(s) 26
ApoI RAATTY 1 cut(s) 13
AsuHPI GGTGA 1 cut(s) 52
BbvI GCAGC 1 cut(s) 38
BciT130I CCWGG 1 cut(s) 41
BfmI CTRYAG 1 cut(s) 191
BisI GCNGC 1 cut(s) 27
BlsI GCNGC 1 cut(s) 28
Bme1390I CCNGG 1 cut(s) 41
BmrFI CCNGG 1 cut(s) 41
BseBI CCWGG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 41
Bst4CI ACNGT 1 cut(s) 106
BstNI CCWGG 1 cut(s) 41
BstSCI CCNGG 1 cut(s) 39
BstSFI CTRYAG 1 cut(s) 191
BstV1I GCAGC 1 cut(s) 38
CviJI RGCY 2 cut(s) 29, 154
CviKI_1 RGCY 2 cut(s) 29, 154
DraI TTTAAA 1 cut(s) 144
EcoRII CCWGG 1 cut(s) 39
FaiI YATR 6 cut(s) 84, 102, 122, 173, 175, 177
Fnu4HI GCNGC 1 cut(s) 27
Fsp4HI GCNGC 1 cut(s) 27
GluI GCNGC 1 cut(s) 27
HindIII AAGCTT 1 cut(s) 152
HinfI GANTC 2 cut(s) 44, 158
HphI GGTGA 1 cut(s) 52
Hpy166II GTNNAC 1 cut(s) 6
Hpy188III TCNNGA 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 6
HpyAV CCTTC 2 cut(s) 16, 67
HpyCH4III ACNGT 1 cut(s) 106
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 3 cut(s) 26, 53, 122
Lsp1109I GCAGC 1 cut(s) 38
MluCI AATT 1 cut(s) 13
MseI TTAA 3 cut(s) 18, 92, 143
MspR9I CCNGG 1 cut(s) 41
MvaI CCWGG 1 cut(s) 41
PfeI GAWTC 2 cut(s) 44, 158
PfoI TCCNGGA 1 cut(s) 39
PkrI GCNGC 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 39
PspGI CCWGG 1 cut(s) 39
SaqAI TTAA 3 cut(s) 18, 92, 143
SatI GCNGC 1 cut(s) 27
ScrFI CCNGG 1 cut(s) 41
SetI ASST 2 cut(s) 59, 156
SfcI CTRYAG 1 cut(s) 191
SgeI CNNG 6 cut(s) 21, 52, 53, 121, 126, 167
Sse9I AATT 1 cut(s) 13
SspI AATATT 2 cut(s) 75, 96
StyD4I CCNGG 1 cut(s) 39
TaaI ACNGT 1 cut(s) 106
TaqI TCGA 1 cut(s) 10
TasI AATT 1 cut(s) 13
TfiI GAWTC 2 cut(s) 44, 158
Tru1I TTAA 3 cut(s) 18, 92, 143
Tru9I TTAA 3 cut(s) 18, 92, 143
TseI GCWGC 1 cut(s) 26
XapI RAATTY 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.