Rmu_sc0000184.1_g000009

26S proteasome non-ATPase regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000184.1
Physical Location & Seq
Reverse (-)
25616 .. 26474
859 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000184.1_g000009.1.cds

Sequence Viewer

Length: 417 bp
atggccctaggaaaagcgctggaacaactcaaggtaacagagagcaagacagttgcaatagggcaaaagatggacttggtgttctatacgctgcagcttggtttcttttacatggattttgacctcatttctaagagcattgagaaagcgaaaaatttatttgaagagggaggtgattgggaaaggaagaatcgcttgaaggtatatgaaggcttgtactgcatgtccactcgaaattttaagaaggtagccgatttgttcctggattctatttctaccttcaccacttacacaatatttccctatgacatcttcatattttataccgtcctgacaagcattatatctttggacagagtttctttaaaacagaagcttgattctttggagcgtatatatgctttccatttgctgtag

Protein Analysis

138

Amino Acids

16.13

Weight (kDa)

7.75

Isoelectric Point (pI)

41.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 154, 235
AfaI GTAC 1 cut(s) 218
AfeI AGCGCT 1 cut(s) 18
AgsI TTSAA 2 cut(s) 164, 199
AjnI CCWGG 1 cut(s) 261
AloI GAACNNNNNNTCC 2 cut(s) 65, 97
AluBI AGCT 2 cut(s) 97, 376
AluI AGCT 2 cut(s) 97, 376
Aor51HI AGCGCT 1 cut(s) 18
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 91, 94
ApoI RAATTY 2 cut(s) 154, 235
AspA2I CCTAGG 1 cut(s) 7
AspLEI GCGC 1 cut(s) 19
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 2 cut(s) 185, 274
AvrII CCTAGG 1 cut(s) 7
BbvI GCAGC 2 cut(s) 78, 106
BccI CCATC 1 cut(s) 64
BciT130I CCWGG 1 cut(s) 263
BfaI CTAG 1 cut(s) 8
BfmI CTRYAG 2 cut(s) 92, 413
BfoI RGCGCY 1 cut(s) 20
BisI GCNGC 2 cut(s) 92, 95
BlnI CCTAGG 1 cut(s) 7
BlsI GCNGC 2 cut(s) 93, 96
Bme1390I CCNGG 1 cut(s) 263
BmgT120I GGNCC 1 cut(s) 4
BmrFI CCNGG 1 cut(s) 263
BpuEI CTTGAG 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 7
BseBI CCWGG 1 cut(s) 263
BseDI CCNNGG 1 cut(s) 7
BseXI GCAGC 2 cut(s) 78, 106
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
BspANI GGCC 1 cut(s) 5
BspMAI CTGCAG 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 7
BssT1I CCWWGG 1 cut(s) 7
Bst2UI CCWGG 1 cut(s) 263
Bst4CI ACNGT 2 cut(s) 52, 328
Bst6I CTCTTC 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 132
BstH2I RGCGCY 1 cut(s) 20
BstHHI GCGC 1 cut(s) 19
BstMWI GCNNNNNNNGC 1 cut(s) 219
BstNI CCWGG 1 cut(s) 263
BstNSI RCATGY 1 cut(s) 226
BstSCI CCNGG 1 cut(s) 261
BstSFI CTRYAG 2 cut(s) 92, 413
BstV1I GCAGC 2 cut(s) 78, 106
BsuRI GGCC 1 cut(s) 5
CfoI GCGC 1 cut(s) 19
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 217
CviAII CATG 2 cut(s) 112, 223
CviJI RGCY 5 cut(s) 5, 97, 213, 251, 376
CviKI_1 RGCY 5 cut(s) 5, 97, 213, 251, 376
CviQI GTAC 1 cut(s) 217
DdeI CTNAG 1 cut(s) 132
DraI TTTAAA 1 cut(s) 366
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
Eco130I CCWWGG 1 cut(s) 7
Eco47III AGCGCT 1 cut(s) 18
EcoRII CCWGG 1 cut(s) 261
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaeI CATG 2 cut(s) 115, 226
FalI AAGNNNNNCTT 4 cut(s) 59, 91, 179, 211
FatI CATG 2 cut(s) 111, 222
Fnu4HI GCNGC 2 cut(s) 92, 95
Fsp4HI GCNGC 2 cut(s) 92, 95
FspBI CTAG 1 cut(s) 8
GlaI GCGC 1 cut(s) 18
GluI GCNGC 2 cut(s) 92, 95
HaeII RGCGCY 1 cut(s) 20
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 19
Hin1II CATG 2 cut(s) 115, 226
Hin6I GCGC 1 cut(s) 17
HinP1I GCGC 1 cut(s) 17
HindIII AAGCTT 1 cut(s) 374
HinfI GANTC 3 cut(s) 190, 266, 380
HphI GGTGA 2 cut(s) 185, 274
Hpy166II GTNNAC 1 cut(s) 228
Hpy188III TCNNGA 1 cut(s) 331
Hpy8I GTNNAC 1 cut(s) 228
HpyAV CCTTC 4 cut(s) 193, 203, 238, 289
HpyCH4III ACNGT 2 cut(s) 52, 328
HpyCH4V TGCA 3 cut(s) 56, 94, 222
HpyF10VI GCNNNNNNNGC 1 cut(s) 219
HpyF3I CTNAG 1 cut(s) 132
Hsp92II CATG 2 cut(s) 115, 226
HspAI GCGC 1 cut(s) 17
LmnI GCTCC 1 cut(s) 388
LpnPI CCDG 4 cut(s) 5, 248, 275, 344
Lsp1109I GCAGC 2 cut(s) 78, 106
MaeI CTAG 1 cut(s) 8
MaeIII GTNAC 1 cut(s) 34
MboII GAAGA 3 cut(s) 176, 199, 304
MluCI AATT 2 cut(s) 154, 235
MnlI CCTC 3 cut(s) 134, 160, 164
MseI TTAA 2 cut(s) 240, 365
MspR9I CCNGG 1 cut(s) 263
MvaI CCWGG 1 cut(s) 263
MwoI GCNNNNNNNGC 1 cut(s) 219
NlaIII CATG 2 cut(s) 115, 226
NspI RCATGY 1 cut(s) 226
PfeI GAWTC 3 cut(s) 190, 266, 380
PfoI TCCNGGA 1 cut(s) 261
PkrI GCNGC 2 cut(s) 93, 96
Psp6I CCWGG 1 cut(s) 261
PspGI CCWGG 1 cut(s) 261
PspPI GGNCC 1 cut(s) 4
PstI CTGCAG 1 cut(s) 96
RsaI GTAC 1 cut(s) 218
RsaNI GTAC 1 cut(s) 217
SaqAI TTAA 2 cut(s) 240, 365
SatI GCNGC 2 cut(s) 92, 95
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 263
SetI ASST 8 cut(s) 36, 99, 126, 175, 204, 249, 281, 378
SfcI CTRYAG 2 cut(s) 92, 413
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
Sse9I AATT 2 cut(s) 154, 235
SspI AATATT 1 cut(s) 297
SspMI CTAG 1 cut(s) 8
StyD4I CCNGG 1 cut(s) 261
StyI CCWWGG 1 cut(s) 7
TaaI ACNGT 2 cut(s) 52, 328
TaqI TCGA 1 cut(s) 232
TasI AATT 2 cut(s) 154, 235
TatI WGTACW 1 cut(s) 216
TfiI GAWTC 3 cut(s) 190, 266, 380
Tru1I TTAA 2 cut(s) 240, 365
Tru9I TTAA 2 cut(s) 240, 365
TseI GCWGC 2 cut(s) 91, 94
TspDTI ATGAA 2 cut(s) 222, 304
XapI RAATTY 2 cut(s) 154, 235
XceI RCATGY 1 cut(s) 226
XmaJI CCTAGG 1 cut(s) 7
XspI CTAG 1 cut(s) 8
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.