RchiOBHm_Chr5g0069501

Glucosidase II beta subunit-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
75345952 .. 75350587
4636 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGATTAGTTCGATTACAGAGATATCCACCTACAAGTATGCAGTTGCTATTAAATGCCCCACACTTTGCAAGCATCCATTATTCCAAGCAGAGAGACCGGTATGGGAGACCATTAATTGTAATGTGCTTCCCAAAGATTACAAGGAAACCCAAGTTGAGGATGAAGAATCTGAAATTAAGTAG

Protein Analysis

60

Amino Acids

6.96

Weight (kDa)

4.97

Isoelectric Point (pI)

48.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 157
AgeI ACCGGT 1 cut(s) 97
Alw26I GTCTC 2 cut(s) 88, 101
AseI ATTAAT 1 cut(s) 114
AsiGI ACCGGT 1 cut(s) 97
BcoDI GTCTC 2 cut(s) 88, 101
BmsI GCATC 1 cut(s) 82
BsaI GGTCTC 2 cut(s) 88, 101
BsaWI WCCGGW 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 157
Bse118I RCCGGY 1 cut(s) 97
BseGI GGATG 2 cut(s) 73, 166
BseLI CCNNNNNNNGG 1 cut(s) 157
BshTI ACCGGT 1 cut(s) 97
BsiSI CCGG 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 157
BsmAI GTCTC 2 cut(s) 88, 101
Bso31I GGTCTC 2 cut(s) 88, 101
BspTNI GGTCTC 2 cut(s) 88, 101
BsrFI RCCGGY 1 cut(s) 97
BssAI RCCGGY 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 71
BstF5I GGATG 2 cut(s) 73, 166
BstMAI GTCTC 2 cut(s) 88, 101
BtsCI GGATG 2 cut(s) 73, 166
Cac8I GCNNGC 1 cut(s) 71
Cfr10I RCCGGY 1 cut(s) 97
CspAI ACCGGT 1 cut(s) 97
Eco31I GGTCTC 2 cut(s) 88, 101
Eco32I GATATC 1 cut(s) 24
EcoRV GATATC 1 cut(s) 24
FaiI YATR 2 cut(s) 39, 103
FokI GGATG 2 cut(s) 60, 173
HapII CCGG 1 cut(s) 98
HinfI GANTC 1 cut(s) 167
HpaII CCGG 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 172
HpyCH4V TGCA 2 cut(s) 41, 69
LpnPI CCDG 1 cut(s) 111
LweI GCATC 1 cut(s) 82
MboII GAAGA 1 cut(s) 176
MluCI AATT 2 cut(s) 115, 174
MnlI CCTC 1 cut(s) 151
MseI TTAA 3 cut(s) 51, 114, 177
MspI CCGG 1 cut(s) 98
PfeI GAWTC 1 cut(s) 167
PinAI ACCGGT 1 cut(s) 97
PshBI ATTAAT 1 cut(s) 114
SaqAI TTAA 3 cut(s) 51, 114, 177
SetI ASST 1 cut(s) 32
SfaNI GCATC 1 cut(s) 82
SgeI CNNG 6 cut(s) 46, 82, 98, 110, 154, 164
Sse9I AATT 2 cut(s) 115, 174
TaqI TCGA 1 cut(s) 11
TasI AATT 2 cut(s) 115, 174
TfiI GAWTC 1 cut(s) 167
Tru1I TTAA 3 cut(s) 51, 114, 177
Tru9I TTAA 3 cut(s) 51, 114, 177
TspDTI ATGAA 1 cut(s) 177
VspI ATTAAT 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.