RchiOBHm_Chr5g0080081

thiosulfate transmembrane transporter activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
85905265 .. 85907826
2562 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 141 bp
ATGGGACCAATTGCAGAGCGTTCGAGAATCATAAGTAAAAGTGTGTTACAAATATTGAGATATGGAGGCCCTTGGTTGAAGAGAGGAGCTGGGTTAGGCCTGGGTGCGAGGGCTATTTCAGCATTCTGTGCCGCTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

46

Amino Acids

4.78

Weight (kDa)

11.45

Isoelectric Point (pI)

39.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 132
AgsI TTSAA 1 cut(s) 79
AjnI CCWGG 1 cut(s) 99
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
AoxI GGCC 2 cut(s) 67, 97
ApeKI GCWGC 1 cut(s) 134
AspS9I GGNCC 2 cut(s) 5, 68
AvaII GGWCC 1 cut(s) 5
BbvI GCAGC 1 cut(s) 121
BcgI CGANNNNNNTGC 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 101
BisI GCNGC 2 cut(s) 132, 135
BlsI GCNGC 2 cut(s) 133, 136
Bme1390I CCNGG 1 cut(s) 101
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 2 cut(s) 5, 68
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 101
BsaJI CCNNGG 2 cut(s) 71, 100
BseBI CCWGG 1 cut(s) 101
BseDI CCNNGG 2 cut(s) 71, 100
BseRI GAGGAG 1 cut(s) 99
BseXI GCAGC 1 cut(s) 121
BseYI CCCAGC 1 cut(s) 89
BshFI GGCC 2 cut(s) 69, 99
BslFI GGGAC 1 cut(s) 18
BsmFI GGGAC 1 cut(s) 18
BsmI GAATGC 1 cut(s) 122
BsnI GGCC 2 cut(s) 69, 99
BspACI CCGC 1 cut(s) 132
BspANI GGCC 2 cut(s) 69, 99
BspLI GGNNCC 1 cut(s) 6
BssECI CCNNGG 2 cut(s) 71, 100
BssT1I CCWWGG 1 cut(s) 71
Bst2UI CCWGG 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 74
BstAPI GCANNNNNTGC 1 cut(s) 128
BstMWI GCNNNNNNNGC 2 cut(s) 119, 128
BstNI CCWGG 1 cut(s) 101
BstSCI CCNGG 1 cut(s) 99
BstV1I GCAGC 1 cut(s) 121
BsuRI GGCC 2 cut(s) 69, 99
Cfr13I GGNCC 2 cut(s) 5, 68
CviJI RGCY 4 cut(s) 69, 89, 99, 113
CviKI_1 RGCY 4 cut(s) 69, 89, 99, 113
Eam1104I CTCTTC 1 cut(s) 74
EarI CTCTTC 1 cut(s) 74
Eco130I CCWWGG 1 cut(s) 71
Eco147I AGGCCT 1 cut(s) 99
Eco47I GGWCC 1 cut(s) 5
EcoO109I RGGNCCY 1 cut(s) 68
EcoRII CCWGG 1 cut(s) 99
EcoT14I CCWWGG 1 cut(s) 71
ErhI CCWWGG 1 cut(s) 71
FaiI YATR 2 cut(s) 32, 63
FaqI GGGAC 1 cut(s) 18
Fnu4HI GCNGC 2 cut(s) 132, 135
Fsp4HI GCNGC 2 cut(s) 132, 135
GluI GCNGC 2 cut(s) 132, 135
GsaI CCCAGC 1 cut(s) 93
HaeIII GGCC 2 cut(s) 69, 99
HinfI GANTC 1 cut(s) 27
Hpy188III TCNNGA 1 cut(s) 24
HpyCH4V TGCA 1 cut(s) 14
HpyF10VI GCNNNNNNNGC 2 cut(s) 119, 128
LmnI GCTCC 1 cut(s) 86
LpnPI CCDG 3 cut(s) 75, 86, 113
Lsp1109I GCAGC 1 cut(s) 121
MaeIII GTNAC 1 cut(s) 45
MboII GAAGA 1 cut(s) 91
MfeI CAATTG 1 cut(s) 9
MluCI AATT 1 cut(s) 9
MnlI CCTC 3 cut(s) 59, 77, 102
MspA1I CMGCKG 1 cut(s) 134
MspR9I CCNGG 1 cut(s) 101
MunI CAATTG 1 cut(s) 9
Mva1269I GAATGC 1 cut(s) 122
MvaI CCWGG 1 cut(s) 101
MwoI GCNNNNNNNGC 2 cut(s) 119, 128
NlaIV GGNNCC 1 cut(s) 6
PceI AGGCCT 1 cut(s) 99
PctI GAATGC 1 cut(s) 122
PfeI GAWTC 1 cut(s) 27
PkrI GCNGC 2 cut(s) 133, 136
Psp6I CCWGG 1 cut(s) 99
PspFI CCCAGC 1 cut(s) 89
PspGI CCWGG 1 cut(s) 99
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 2 cut(s) 5, 68
SatI GCNGC 2 cut(s) 132, 135
Sau96I GGNCC 2 cut(s) 5, 68
ScrFI CCNGG 1 cut(s) 101
SetI ASST 1 cut(s) 91
SgeI CNNG 6 cut(s) 36, 84, 102, 112, 113, 120
SinI GGWCC 1 cut(s) 5
Sse9I AATT 1 cut(s) 9
SseBI AGGCCT 1 cut(s) 99
SsiI CCGC 1 cut(s) 132
SspI AATATT 1 cut(s) 54
StuI AGGCCT 1 cut(s) 99
StyD4I CCNGG 1 cut(s) 99
StyI CCWWGG 1 cut(s) 71
TaqI TCGA 1 cut(s) 23
TasI AATT 1 cut(s) 9
TauI GCSGC 1 cut(s) 134
TfiI GAWTC 1 cut(s) 27
TseI GCWGC 1 cut(s) 134
VpaK11BI GGWCC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.