RchiOBHm_Chr3g0481731

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
27842689 .. 27843010
322 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44664

Sequence Viewer

Length: 150 bp
ATGAAGGGCTTGGCAGCATGGCGCGCAGCATGTCGGCAGCATGTCGACAGCATTAGCTGTTGCGTGACTATTCTTCAGACGACGGACGACTTTAGAAACTGTCGTGTGAAGGCAATTCAGAGGTCACTTTATTTTATACCCGTTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.59

Weight (kDa)

9.24

Isoelectric Point (pI)

47.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 45
AccII CGCG 1 cut(s) 24
AcuI CTGAAG 1 cut(s) 59
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
ApeKI GCWGC 3 cut(s) 14, 26, 37
AspLEI GCGC 2 cut(s) 24, 26
BbvI GCAGC 3 cut(s) 26, 38, 49
BisI GCNGC 3 cut(s) 15, 27, 38
BlsI GCNGC 3 cut(s) 16, 28, 39
BsePI GCGCGC 1 cut(s) 22
BseXI GCAGC 3 cut(s) 26, 38, 49
Bsh1236I CGCG 1 cut(s) 24
BspFNI CGCG 1 cut(s) 24
BssHII GCGCGC 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 101
BstC8I GCNNGC 1 cut(s) 24
BstFNI CGCG 1 cut(s) 24
BstHHI GCGC 2 cut(s) 24, 26
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstNSI RCATGY 2 cut(s) 33, 44
BstUI CGCG 1 cut(s) 24
BstV1I GCAGC 3 cut(s) 26, 38, 49
Cac8I GCNNGC 1 cut(s) 24
CfoI GCGC 2 cut(s) 24, 26
CviAII CATG 3 cut(s) 18, 30, 41
CviJI RGCY 2 cut(s) 9, 57
CviKI_1 RGCY 2 cut(s) 9, 57
Eco57I CTGAAG 1 cut(s) 59
FaeI CATG 3 cut(s) 21, 33, 44
FaiI YATR 4 cut(s) 19, 31, 42, 137
FatI CATG 3 cut(s) 17, 29, 40
FblI GTMKAC 1 cut(s) 45
Fnu4HI GCNGC 3 cut(s) 15, 27, 38
Fsp4HI GCNGC 3 cut(s) 15, 27, 38
FspEI CC 5 cut(s) 4, 19, 68, 95, 106
GlaI GCGC 2 cut(s) 23, 25
GluI GCNGC 3 cut(s) 15, 27, 38
HhaI GCGC 2 cut(s) 24, 26
Hin1II CATG 3 cut(s) 21, 33, 44
Hin6I GCGC 2 cut(s) 22, 24
HinP1I GCGC 2 cut(s) 22, 24
HincII GTYRAC 1 cut(s) 46
HindII GTYRAC 1 cut(s) 46
Hpy166II GTNNAC 1 cut(s) 46
Hpy188I TCNGA 2 cut(s) 78, 120
Hpy8I GTNNAC 1 cut(s) 46
Hpy99I CGWCG 1 cut(s) 85
HpyAV CCTTC 1 cut(s) 103
HpyCH4III ACNGT 1 cut(s) 101
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
Hsp92II CATG 3 cut(s) 21, 33, 44
HspAI GCGC 2 cut(s) 22, 24
Lsp1109I GCAGC 3 cut(s) 26, 38, 49
MaeIII GTNAC 2 cut(s) 64, 123
MboII GAAGA 1 cut(s) 65
MluCI AATT 1 cut(s) 114
MnlI CCTC 1 cut(s) 114
MvnI CGCG 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 23
NlaIII CATG 3 cut(s) 21, 33, 44
NmuCI GTSAC 2 cut(s) 64, 123
NspI RCATGY 2 cut(s) 33, 44
PauI GCGCGC 1 cut(s) 22
PkrI GCNGC 3 cut(s) 16, 28, 39
PteI GCGCGC 1 cut(s) 22
SalI GTCGAC 1 cut(s) 44
SatI GCNGC 3 cut(s) 15, 27, 38
SetI ASST 2 cut(s) 59, 125
SgeI CNNG 7 cut(s) 22, 30, 35, 42, 53, 76, 116
Sse9I AATT 1 cut(s) 114
TaaI ACNGT 1 cut(s) 101
TaqI TCGA 1 cut(s) 45
TasI AATT 1 cut(s) 114
TseFI GTSAC 2 cut(s) 64, 123
TseI GCWGC 3 cut(s) 14, 26, 37
Tsp45I GTSAC 2 cut(s) 64, 123
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 98
XceI RCATGY 2 cut(s) 33, 44
XmiI GTMKAC 1 cut(s) 45
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.