Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr5

Orthogroup ID

OG0006401

Physical Location & Seq

Genomic Coordinates Reverse (-)

84189608 .. 84192865

Gene Structure 3258 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw5G048410.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 429 bp

ATGGGGATGATTCCTGGTATGGTTTTGGTTGATGCTTTTGGTCAGATACTTGGATTCTACAACCTTCTGAGAGGAAAAGTAGTTGCTAGAAATGATGGTATGCGACCAAGTCTTTATCAGGAAGCTGCTACTGGTTTAATTGCTGGAGCAGCTGGAGTGTATCTCAGCTTTCCATTTGCTGTAGCTTGTCAACATAAGCAGGTTGAATCCATGGGACCAATTGCAGAGCGTTCGAGAATCATAAGTAAAAGTGTGTTACAAATATTGAGATATGGAGGCCCTTGGTTGAAGAGAGGAGCTGGGTTAGGCCTGGGTGCAAGGGCTGTTTCAGCATTCTGTGCCGCTGCTTGCGCTGAACTGGCACAACAAGCTAGCTCCTTCAATTCTGCGCGTCAAACTCCAAACAAAAAGACCCGTTGCATTCTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04964 map04964

Pfam Domains

Protein Families

Mito_carr

Protein Analysis

142

Amino Acids

15.05

Weight (kDa)

10.04

Isoelectric Point (pI)

43.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006401)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g45501
malus_domestica	MD11G1004000.v1.1
rosa_chinensis	RchiOBHm_Chr2g0108941 RchiOBHm_Chr3g0481731 RchiOBHm_Chr5g0034121 RchiOBHm_Chr5g0080081 RchiOBHm_Chr5g0083321
rosa_laevigata	RLG00000037028
rosa_multiflora	Rmu_co8166610.1_g000001 Rmu_sc0001444.1_g000019 Rmu_sc0002245.1_g000052 Rmu_sc0004031.1_g000008 Rmu_sc0008014.1_g000008
rosa_roxburghii	Rroxscaffold_175G00431920 Rroxscaffold_1G00001190 Rroxscaffold_1G00015050 Rroxscaffold_1G00053210 Rroxscaffold_3G00246580
rosa_rugosa	Rorug05G0484200
rosa_samantha	Rh5AG128000 Rh5AG521900 Rh5AG533500 Rh5BG561100 Rh5CG583700
rosa_wichuraiana	Rw1G036530 Rw5G048410 Rw5G049930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	190
AccII	CGCG	1 cut(s)	391
AciI	CCGC	1 cut(s)	342
AgsI	TTSAA	3 cut(s)	206, 289, 382
AjnI	CCWGG	2 cut(s)	13, 309
AluBI	AGCT	7 cut(s)	125, 152, 168, 185, 299, 371, 375
AluI	AGCT	7 cut(s)	125, 152, 168, 185, 299, 371, 375
AoxI	GGCC	2 cut(s)	277, 307
ApeKI	GCWGC	3 cut(s)	125, 149, 344
AspLEI	GCGC	2 cut(s)	353, 391
AspS9I	GGNCC	2 cut(s)	215, 278
AsuNHI	GCTAGC	1 cut(s)	371
AvaII	GGWCC	1 cut(s)	215
BbvI	GCAGC	3 cut(s)	112, 161, 331
BccI	CCATC	1 cut(s)	89
BcgI	CGANNNNNNTGC	2 cut(s)	213, 247
BciT130I	CCWGG	2 cut(s)	15, 311
BfaI	CTAG	2 cut(s)	87, 372
BfmI	CTRYAG	1 cut(s)	180
BfuAI	ACCTGC	1 cut(s)	190
BisI	GCNGC	4 cut(s)	126, 150, 342, 345
BlsI	GCNGC	4 cut(s)	127, 151, 343, 346
Bme1390I	CCNGG	2 cut(s)	15, 311
Bme18I	GGWCC	1 cut(s)	215
BmgT120I	GGNCC	2 cut(s)	215, 278
BmiI	GGNNCC	1 cut(s)	216
BmrFI	CCNGG	2 cut(s)	15, 311
BmsI	GCATC	1 cut(s)	22
BmtI	GCTAGC	1 cut(s)	375
BplI	GAGNNNNNCTC	2 cut(s)	147, 179
BpmI	CTGGAG	2 cut(s)	165, 174
BsaJI	CCNNGG	3 cut(s)	210, 281, 310
Bse1I	ACTGG	2 cut(s)	136, 363
BseBI	CCWGG	2 cut(s)	15, 311
BseDI	CCNNGG	3 cut(s)	210, 281, 310
BseGI	GGATG	1 cut(s)	12
BseMII	CTCAG	2 cut(s)	59, 178
BseNI	ACTGG	2 cut(s)	136, 363
BseRI	GAGGAG	1 cut(s)	309
BseXI	GCAGC	3 cut(s)	112, 161, 331
BseYI	CCCAGC	1 cut(s)	299
Bsh1236I	CGCG	1 cut(s)	391
BshFI	GGCC	2 cut(s)	279, 309
BslFI	GGGAC	1 cut(s)	228
BsmFI	GGGAC	1 cut(s)	228
BsmI	GAATGC	2 cut(s)	332, 420
BsnI	GGCC	2 cut(s)	279, 309
Bsp19I	CCATGG	1 cut(s)	210
BspACI	CCGC	1 cut(s)	342
BspANI	GGCC	2 cut(s)	279, 309
BspCNI	CTCAG	2 cut(s)	60, 177
BspFNI	CGCG	1 cut(s)	391
BspLI	GGNNCC	1 cut(s)	216
BspMI	ACCTGC	1 cut(s)	190
BspOI	GCTAGC	1 cut(s)	375
BsrI	ACTGG	2 cut(s)	136, 363
BssECI	CCNNGG	3 cut(s)	210, 281, 310
BssT1I	CCWWGG	2 cut(s)	210, 281
Bst2UI	CCWGG	2 cut(s)	15, 311
Bst6I	CTCTTC	1 cut(s)	284
BstAPI	GCANNNNNTGC	1 cut(s)	338
BstC8I	GCNNGC	2 cut(s)	349, 373
BstDEI	CTNAG	2 cut(s)	68, 164
BstDSI	CCRYGG	1 cut(s)	210
BstF5I	GGATG	1 cut(s)	12
BstFNI	CGCG	1 cut(s)	391
BstHHI	GCGC	2 cut(s)	353, 391
BstMWI	GCNNNNNNNGC	6 cut(s)	149, 329, 338, 350, 359, 368
BstNI	CCWGG	2 cut(s)	15, 311
BstSCI	CCNGG	2 cut(s)	13, 309
BstSFI	CTRYAG	1 cut(s)	180
BstUI	CGCG	1 cut(s)	391
BstV1I	GCAGC	3 cut(s)	112, 161, 331
BsuRI	GGCC	2 cut(s)	279, 309
BtgI	CCRYGG	1 cut(s)	210
BtsCI	GGATG	1 cut(s)	12
BveI	ACCTGC	1 cut(s)	190
Cac8I	GCNNGC	2 cut(s)	349, 373
CfoI	GCGC	2 cut(s)	353, 391
Cfr13I	GGNCC	2 cut(s)	215, 278
CseI	GACGC	1 cut(s)	380
CviAII	CATG	1 cut(s)	211
DdeI	CTNAG	2 cut(s)	68, 164
Eam1104I	CTCTTC	1 cut(s)	284
EarI	CTCTTC	1 cut(s)	284
Eco130I	CCWWGG	2 cut(s)	210, 281
Eco147I	AGGCCT	1 cut(s)	309
Eco47I	GGWCC	1 cut(s)	215
EcoO109I	RGGNCCY	1 cut(s)	278
EcoRII	CCWGG	2 cut(s)	13, 309
EcoT14I	CCWWGG	2 cut(s)	210, 281
ErhI	CCWWGG	2 cut(s)	210, 281
FaeI	CATG	1 cut(s)	214
FaiI	YATR	6 cut(s)	20, 101, 195, 212, 242, 273
FaqI	GGGAC	1 cut(s)	228
FatI	CATG	1 cut(s)	210
Fnu4HI	GCNGC	4 cut(s)	126, 150, 342, 345
FokI	GGATG	1 cut(s)	19
Fsp4HI	GCNGC	4 cut(s)	126, 150, 342, 345
FspBI	CTAG	2 cut(s)	87, 372
GlaI	GCGC	2 cut(s)	352, 390
GluI	GCNGC	4 cut(s)	126, 150, 342, 345
GsaI	CCCAGC	1 cut(s)	303
GsuI	CTGGAG	2 cut(s)	165, 174
HaeIII	GGCC	2 cut(s)	279, 309
HgaI	GACGC	1 cut(s)	380
HhaI	GCGC	2 cut(s)	353, 391
Hin1II	CATG	1 cut(s)	214
Hin6I	GCGC	2 cut(s)	351, 389
HinP1I	GCGC	2 cut(s)	351, 389
HincII	GTYRAC	1 cut(s)	191
HindII	GTYRAC	1 cut(s)	191
HinfI	GANTC	4 cut(s)	10, 54, 206, 237
Hpy166II	GTNNAC	1 cut(s)	191
Hpy188I	TCNGA	2 cut(s)	45, 69
Hpy188III	TCNNGA	2 cut(s)	119, 234
Hpy8I	GTNNAC	1 cut(s)	191
HpyAV	CCTTC	2 cut(s)	74, 388
HpyCH4V	TGCA	3 cut(s)	224, 317, 420
HpyF10VI	GCNNNNNNNGC	6 cut(s)	149, 329, 338, 350, 359, 368
HpyF3I	CTNAG	2 cut(s)	68, 164
Hsp92II	CATG	1 cut(s)	214
HspAI	GCGC	2 cut(s)	351, 389
LmnI	GCTCC	3 cut(s)	146, 296, 380
Lsp1109I	GCAGC	3 cut(s)	112, 161, 331
LweI	GCATC	1 cut(s)	22
MaeI	CTAG	2 cut(s)	87, 372
MaeIII	GTNAC	1 cut(s)	255
MboII	GAAGA	1 cut(s)	301
MfeI	CAATTG	1 cut(s)	219
MluCI	AATT	3 cut(s)	138, 219, 382
MnlI	CCTC	3 cut(s)	65, 269, 287
MseI	TTAA	1 cut(s)	137
MspA1I	CMGCKG	2 cut(s)	152, 344
MspR9I	CCNGG	2 cut(s)	15, 311
MunI	CAATTG	1 cut(s)	219
Mva1269I	GAATGC	2 cut(s)	332, 420
MvaI	CCWGG	2 cut(s)	15, 311
MvnI	CGCG	1 cut(s)	391
MwoI	GCNNNNNNNGC	6 cut(s)	149, 329, 338, 350, 359, 368
NcoI	CCATGG	1 cut(s)	210
NheI	GCTAGC	1 cut(s)	371
NlaIII	CATG	1 cut(s)	214
NlaIV	GGNNCC	1 cut(s)	216
PceI	AGGCCT	1 cut(s)	309
PctI	GAATGC	2 cut(s)	332, 420
PfeI	GAWTC	4 cut(s)	10, 54, 206, 237
PflFI	GACNNNGTC	1 cut(s)	108
PkrI	GCNGC	4 cut(s)	127, 151, 343, 346
Psp6I	CCWGG	2 cut(s)	13, 309
PspFI	CCCAGC	1 cut(s)	299
PspGI	CCWGG	2 cut(s)	13, 309
PspN4I	GGNNCC	1 cut(s)	216
PspPI	GGNCC	2 cut(s)	215, 278
PsyI	GACNNNGTC	1 cut(s)	108
PvuII	CAGCTG	1 cut(s)	152
SaqAI	TTAA	1 cut(s)	137
SatI	GCNGC	4 cut(s)	126, 150, 342, 345
Sau96I	GGNCC	2 cut(s)	215, 278
ScrFI	CCNGG	2 cut(s)	15, 311
SetI	ASST	9 cut(s)	66, 127, 154, 170, 187, 204, 301, 373, 377
SfaNI	GCATC	1 cut(s)	22
SfcI	CTRYAG	1 cut(s)	180
SinI	GGWCC	1 cut(s)	215
Sse9I	AATT	3 cut(s)	138, 219, 382
SseBI	AGGCCT	1 cut(s)	309
SsiI	CCGC	1 cut(s)	342
SspI	AATATT	1 cut(s)	264
SspMI	CTAG	2 cut(s)	87, 372
StuI	AGGCCT	1 cut(s)	309
StyD4I	CCNGG	2 cut(s)	13, 309
StyI	CCWWGG	2 cut(s)	210, 281
TaqI	TCGA	1 cut(s)	233
TasI	AATT	3 cut(s)	138, 219, 382
TauI	GCSGC	1 cut(s)	344
TfiI	GAWTC	4 cut(s)	10, 54, 206, 237
Tru1I	TTAA	1 cut(s)	137
Tru9I	TTAA	1 cut(s)	137
TseI	GCWGC	3 cut(s)	125, 149, 344
Tth111I	GACNNNGTC	1 cut(s)	108
VpaK11BI	GGWCC	1 cut(s)	215
XspI	CTAG	2 cut(s)	87, 372

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.