RchiOBHm_Chr2g0108941

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
20376418 .. 20377912
1495 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48280

Sequence Viewer

Length: 192 bp
ATGCAATATATTTATTTCTTGAGTTTGATCACAGTCACTACTACAGAAATTGAAACAGACGACAGGCAAAAACTGTCGTCTGATATGGAGGCTGACCGTCGTATATTGAGGTGCCATCTGATGAAGGTCGATTGTAGGGAACCGTCATATGAAGGGATCGGCAGCATTCCGGCAACCTGTCGACAGCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.37

Weight (kDa)

5.53

Isoelectric Point (pI)

46.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 111
AccI GTMKAC 1 cut(s) 181
AclWI GGATC 1 cut(s) 164
AgsI TTSAA 1 cut(s) 53
AlwI GGATC 1 cut(s) 164
ApeKI GCWGC 1 cut(s) 162
BanI GGYRCC 1 cut(s) 111
BbvI GCAGC 1 cut(s) 174
BccI CCATC 1 cut(s) 123
BclI TGATCA 1 cut(s) 27
BfmI CTRYAG 1 cut(s) 42
BisI GCNGC 1 cut(s) 163
BlsI GCNGC 1 cut(s) 164
BmiI GGNNCC 2 cut(s) 113, 141
BpuEI CTTGAG 1 cut(s) 40
BseXI GCAGC 1 cut(s) 174
BshNI GGYRCC 1 cut(s) 111
BsiSI CCGG 1 cut(s) 170
BsmI GAATGC 1 cut(s) 165
Bsp143I GATC 2 cut(s) 27, 156
BspLI GGNNCC 2 cut(s) 113, 141
BspPI GGATC 1 cut(s) 164
BspT107I GGYRCC 1 cut(s) 111
BssMI GATC 2 cut(s) 27, 156
Bst4CI ACNGT 4 cut(s) 34, 75, 98, 144
BstKTI GATC 2 cut(s) 30, 159
BstMBI GATC 2 cut(s) 27, 156
BstSFI CTRYAG 1 cut(s) 42
BstV1I GCAGC 1 cut(s) 174
CviJI RGCY 1 cut(s) 92
CviKI_1 RGCY 1 cut(s) 92
DpnI GATC 2 cut(s) 29, 158
DpnII GATC 2 cut(s) 27, 156
FaiI YATR 5 cut(s) 9, 86, 104, 148, 150
FauNDI CATATG 1 cut(s) 148
FbaI TGATCA 1 cut(s) 27
FblI GTMKAC 1 cut(s) 181
Fnu4HI GCNGC 1 cut(s) 163
Fsp4HI GCNGC 1 cut(s) 163
GluI GCNGC 1 cut(s) 163
HapII CCGG 1 cut(s) 170
HincII GTYRAC 1 cut(s) 182
HindII GTYRAC 1 cut(s) 182
HpaII CCGG 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 182
Hpy188I TCNGA 2 cut(s) 82, 120
Hpy188III TCNNGA 1 cut(s) 19
Hpy8I GTNNAC 1 cut(s) 182
Hpy99I CGWCG 1 cut(s) 102
HpyAV CCTTC 2 cut(s) 118, 146
HpyCH4III ACNGT 4 cut(s) 34, 75, 98, 144
HpyCH4V TGCA 1 cut(s) 4
Ksp22I TGATCA 1 cut(s) 27
Kzo9I GATC 2 cut(s) 27, 156
LpnPI CCDG 2 cut(s) 49, 183
Lsp1109I GCAGC 1 cut(s) 174
MaeIII GTNAC 1 cut(s) 34
MalI GATC 2 cut(s) 29, 158
MboI GATC 2 cut(s) 27, 156
MluCI AATT 1 cut(s) 48
MnlI CCTC 2 cut(s) 82, 102
MspI CCGG 1 cut(s) 170
Mva1269I GAATGC 1 cut(s) 165
NdeI CATATG 1 cut(s) 148
NdeII GATC 2 cut(s) 27, 156
NlaIV GGNNCC 2 cut(s) 113, 141
NmuCI GTSAC 1 cut(s) 34
PctI GAATGC 1 cut(s) 165
PkrI GCNGC 1 cut(s) 164
PspN4I GGNNCC 2 cut(s) 113, 141
SalI GTCGAC 1 cut(s) 180
SatI GCNGC 1 cut(s) 163
Sau3AI GATC 2 cut(s) 27, 156
SetI ASST 3 cut(s) 113, 129, 179
SfcI CTRYAG 1 cut(s) 42
SgeI CNNG 3 cut(s) 31, 76, 182
SmlI CTYRAG 1 cut(s) 19
SmoI CTYRAG 1 cut(s) 19
Sse9I AATT 1 cut(s) 48
TaaI ACNGT 4 cut(s) 34, 75, 98, 144
TaqI TCGA 2 cut(s) 129, 181
TasI AATT 1 cut(s) 48
TseFI GTSAC 1 cut(s) 34
TseI GCWGC 1 cut(s) 162
Tsp45I GTSAC 1 cut(s) 34
TspDTI ATGAA 2 cut(s) 137, 165
XmiI GTMKAC 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.