RchiOBHm_Chr4g0385331

Autophagy-related protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
783897 .. 785009
1113 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 129 bp
ATGGAGGTCCCAATAGAAAAAGTCTTCATACGGACATTTGTCGCTGCATCTGTGGAAGAGGAGTACGAAGTTGGAGGTGTGGAAGTTCTTATTGATAATGAAGATAATGATGGCTGGTTGGGAACATAA

Protein Analysis

42

Amino Acids

4.7

Weight (kDa)

4.05

Isoelectric Point (pI)

48.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 65
ApeKI GCWGC 1 cut(s) 44
AspS9I GGNCC 1 cut(s) 7
AvaII GGWCC 1 cut(s) 7
BbsI GAAGAC 1 cut(s) 16
BbvI GCAGC 1 cut(s) 31
BccI CCATC 1 cut(s) 104
BisI GCNGC 1 cut(s) 45
BlsI GCNGC 1 cut(s) 46
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BmiI GGNNCC 1 cut(s) 9
BmsI GCATC 1 cut(s) 56
BoxI GACNNNNGTC 1 cut(s) 38
BpiI GAAGAC 1 cut(s) 16
BseRI GAGGAG 1 cut(s) 74
BseXI GCAGC 1 cut(s) 31
BspLI GGNNCC 1 cut(s) 9
Bst6I CTCTTC 1 cut(s) 51
BstPAI GACNNNNGTC 1 cut(s) 38
BstV1I GCAGC 1 cut(s) 31
BstV2I GAAGAC 1 cut(s) 16
Cfr13I GGNCC 1 cut(s) 7
Csp6I GTAC 1 cut(s) 64
CviJI RGCY 1 cut(s) 114
CviKI_1 RGCY 1 cut(s) 114
CviQI GTAC 1 cut(s) 64
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 7
EcoO109I RGGNCCY 1 cut(s) 7
FaiI YATR 2 cut(s) 29, 127
Fnu4HI GCNGC 1 cut(s) 45
Fsp4HI GCNGC 1 cut(s) 45
GluI GCNGC 1 cut(s) 45
HpyCH4V TGCA 1 cut(s) 47
LpnPI CCDG 1 cut(s) 100
Lsp1109I GCAGC 1 cut(s) 31
LweI GCATC 1 cut(s) 56
MboII GAAGA 3 cut(s) 16, 68, 113
MmeI TCCRAC 1 cut(s) 52
MnlI CCTC 2 cut(s) 52, 68
NlaIV GGNNCC 1 cut(s) 9
PkrI GCNGC 1 cut(s) 46
PpuMI RGGWCCY 1 cut(s) 7
PshAI GACNNNNGTC 1 cut(s) 38
Psp5II RGGWCCY 1 cut(s) 7
PspN4I GGNNCC 1 cut(s) 9
PspPI GGNCC 1 cut(s) 7
PspPPI RGGWCCY 1 cut(s) 7
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SatI GCNGC 1 cut(s) 45
Sau96I GGNCC 1 cut(s) 7
SetI ASST 2 cut(s) 9, 79
SfaNI GCATC 1 cut(s) 56
SinI GGWCC 1 cut(s) 7
TseI GCWGC 1 cut(s) 44
TspDTI ATGAA 2 cut(s) 16, 114
TspGWI ACGGA 1 cut(s) 46
VpaK11BI GGWCC 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.