RchiOBHm_Chr4g0400591

Methyltransferase required for the conversion of 2- polyprenyl-6-methoxy-1,4-benzoquinol (DDMQH2) to 2-polyprenyl-3- methyl-6-methoxy-1,4-benzoquinol (DMQH2)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
18309737 .. 18309954
218 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 135 bp
ATGCATAATGAAGGAGACATTTGGAATATGTATGAGACATTTGCTTCAATGATTGCAGATGCAGGTTTCCAGAAGGTTGAGTATGAAAATCTAGTTGGAGGAGTGGTAGCGATTCATTCAGGGTTGAAAATTTAG

Protein Analysis

44

Amino Acids

4.89

Weight (kDa)

4.63

Isoelectric Point (pI)

31.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ubie_methyltran PF01209 11 - 43 3.9e-09 ubiE/COQ5 methyltransferase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 53
AcsI RAATTY 1 cut(s) 129
AgsI TTSAA 2 cut(s) 48, 127
AjuI GAANNNNNNNTTGG 2 cut(s) 78, 110
Alw26I GTCTC 2 cut(s) 9, 29
ApoI RAATTY 1 cut(s) 129
BcoDI GTCTC 2 cut(s) 9, 29
BfaI CTAG 1 cut(s) 92
BfuAI ACCTGC 1 cut(s) 53
BmsI GCATC 1 cut(s) 49
BsaXI ACNNNNNCTCC 2 cut(s) 90, 120
BseRI GAGGAG 1 cut(s) 114
BsmAI GTCTC 2 cut(s) 9, 29
BspMI ACCTGC 1 cut(s) 53
BstMAI GTCTC 2 cut(s) 9, 29
BveI ACCTGC 1 cut(s) 53
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 4 cut(s) 6, 29, 33, 84
FspBI CTAG 1 cut(s) 92
FspEI CC 9 cut(s) 7, 48, 59, 81, 83, 84, 89, 105, 106
HinfI GANTC 1 cut(s) 112
Hpy188III TCNNGA 1 cut(s) 70
HpyAV CCTTC 2 cut(s) 5, 67
HpyCH4V TGCA 3 cut(s) 4, 56, 62
LpnPI CCDG 3 cut(s) 48, 83, 105
LweI GCATC 1 cut(s) 49
MaeI CTAG 1 cut(s) 92
MluCI AATT 1 cut(s) 129
MmeI TCCRAC 1 cut(s) 76
MnlI CCTC 1 cut(s) 92
Mph1103I ATGCAT 1 cut(s) 6
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 112
SetI ASST 2 cut(s) 67, 78
SfaNI GCATC 1 cut(s) 49
SgeI CNNG 3 cut(s) 75, 82, 104
Sse9I AATT 1 cut(s) 129
SspMI CTAG 1 cut(s) 92
TasI AATT 1 cut(s) 129
TfiI GAWTC 1 cut(s) 112
TspDTI ATGAA 3 cut(s) 24, 99, 104
XapI RAATTY 1 cut(s) 129
XspI CTAG 1 cut(s) 92
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.