RchiOBHm_Chr4g0400661

Methyltransferase required for the conversion of 2- polyprenyl-6-methoxy-1,4-benzoquinol (DDMQH2) to 2-polyprenyl-3- methyl-6-methoxy-1,4-benzoquinol (DMQH2)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0002791
Physical Location & Seq
Reverse (-)
18387077 .. 18389305
2229 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37265

Sequence Viewer

Length: 471 bp
ATGGCCTTGAGAACAGTGTCGAGGAAGATAGGGAGTAAACTGTTACCCAGGTTTTGTCCTGCATCTCTATTGCATTCTCATGCCACAAGCTTTGGATTCAAGGAAGTACGGGAAGAGGAAAAAAGTCAAATGGTTGGTAATGTCTTCAGCAATGTTGCTTCAAACTATGATACAATGAATGATTTGATGAGTGCAGGATTACACAGATTATGGAAGGATAGATTGGTTTCAAAACTGAATCCTTTTCCTGGAATGAACCATCTTGATGTGGCTGGTGGGACAGGTGATGTTGCTTTCAGAATACTAGACAGTATAAACAGCATCAAACATAGAGCTTTGCTGAATGTTCTTGAAGATGATTTACAGGAAGAAACTAAGGTGTATGTATGTGACATCAATTCCAACATGTTGAATGTTGGTAAAAAAAGGGCCTTGCAGAGAGGTCTTGGAGAAGACAAATCCCTTCTATAG

Protein Analysis

156

Amino Acids

17.4

Weight (kDa)

8.95

Isoelectric Point (pI)

36.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ubie_methyltran PF01209 40 - 148 5.5e-27 ubiE/COQ5 methyltransferase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 130
AfaI GTAC 1 cut(s) 108
AfiI CCNNNNNNNGG 1 cut(s) 248
AflIII ACRYGT 1 cut(s) 405
AgsI TTSAA 5 cut(s) 100, 162, 231, 353, 412
AjnI CCWGG 2 cut(s) 47, 247
AjuI GAANNNNNNNTTGG 2 cut(s) 206, 238
AluBI AGCT 2 cut(s) 90, 335
AluI AGCT 2 cut(s) 90, 335
AoxI GGCC 2 cut(s) 3, 429
AspS9I GGNCC 1 cut(s) 429
AsuHPI GGTGA 1 cut(s) 296
BarI GAAGNNNNNNTAC 2 cut(s) 345, 377
BbsI GAAGAC 2 cut(s) 136, 459
BccI CCATC 1 cut(s) 267
BciT130I CCWGG 2 cut(s) 49, 249
BfaI CTAG 1 cut(s) 305
BfmI CTRYAG 1 cut(s) 467
Bme1390I CCNGG 2 cut(s) 49, 249
BmgT120I GGNCC 1 cut(s) 429
BmrFI CCNGG 2 cut(s) 49, 249
BmsI GCATC 2 cut(s) 71, 330
BpiI GAAGAC 2 cut(s) 136, 459
BpuEI CTTGAG 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 47
Bsc4I CCNNNNNNNGG 1 cut(s) 248
Bse3DI GCAATG 1 cut(s) 157
BseBI CCWGG 2 cut(s) 49, 249
BseDI CCNNGG 1 cut(s) 47
BseLI CCNNNNNNNGG 1 cut(s) 248
BseMI GCAATG 1 cut(s) 157
BsgI GTGCAG 1 cut(s) 213
BshFI GGCC 2 cut(s) 5, 431
BslFI GGGAC 1 cut(s) 292
BslI CCNNNNNNNGG 1 cut(s) 248
BsmFI GGGAC 1 cut(s) 292
BsmI GAATGC 1 cut(s) 73
BsnI GGCC 2 cut(s) 5, 431
BspANI GGCC 2 cut(s) 5, 431
BsrDI GCAATG 1 cut(s) 157
BssECI CCNNGG 1 cut(s) 47
Bst2UI CCWGG 2 cut(s) 49, 249
Bst4CI ACNGT 3 cut(s) 16, 42, 311
Bst6I CTCTTC 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 375
BstNI CCWGG 2 cut(s) 49, 249
BstNSI RCATGY 1 cut(s) 409
BstSCI CCNGG 2 cut(s) 47, 247
BstSFI CTRYAG 1 cut(s) 467
BstV2I GAAGAC 2 cut(s) 136, 459
BsuRI GGCC 2 cut(s) 5, 431
BtsIMutI CAGTG 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 429
Csp6I GTAC 1 cut(s) 107
CspCI CAANNNNNGTGG 2 cut(s) 73, 108
CviAII CATG 2 cut(s) 80, 406
CviJI RGCY 5 cut(s) 5, 90, 272, 335, 431
CviKI_1 RGCY 5 cut(s) 5, 90, 272, 335, 431
CviQI GTAC 1 cut(s) 107
DdeI CTNAG 1 cut(s) 375
Eam1104I CTCTTC 1 cut(s) 108
EarI CTCTTC 1 cut(s) 108
Eco57I CTGAAG 1 cut(s) 130
EcoO109I RGGNCCY 1 cut(s) 429
EcoRII CCWGG 2 cut(s) 47, 247
FaeI CATG 2 cut(s) 83, 409
FaiI YATR 9 cut(s) 81, 168, 211, 314, 330, 384, 388, 407, 469
FaqI GGGAC 1 cut(s) 292
FatI CATG 2 cut(s) 79, 405
FspBI CTAG 1 cut(s) 305
HaeIII GGCC 2 cut(s) 5, 431
Hin1II CATG 2 cut(s) 83, 409
HindIII AAGCTT 1 cut(s) 88
HinfI GANTC 2 cut(s) 96, 238
HphI GGTGA 1 cut(s) 296
Hpy166II GTNNAC 1 cut(s) 38
Hpy188I TCNGA 1 cut(s) 299
Hpy188III TCNNGA 2 cut(s) 263, 350
Hpy8I GTNNAC 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 208
HpyCH4III ACNGT 3 cut(s) 16, 42, 311
HpyCH4V TGCA 4 cut(s) 62, 73, 194, 436
HpyF3I CTNAG 1 cut(s) 375
Hsp92II CATG 2 cut(s) 83, 409
LpnPI CCDG 9 cut(s) 34, 61, 72, 180, 234, 258, 261, 267, 350
LweI GCATC 2 cut(s) 71, 330
MaeI CTAG 1 cut(s) 305
MaeIII GTNAC 2 cut(s) 42, 389
MboII GAAGA 6 cut(s) 37, 125, 136, 365, 380, 464
MluCI AATT 1 cut(s) 397
MmeI TCCRAC 1 cut(s) 426
MnlI CCTC 3 cut(s) 15, 109, 434
MslI CAYNNNNRTG 2 cut(s) 78, 264
MspR9I CCNGG 2 cut(s) 49, 249
Mva1269I GAATGC 1 cut(s) 73
MvaI CCWGG 2 cut(s) 49, 249
NlaIII CATG 2 cut(s) 83, 409
NmuCI GTSAC 1 cut(s) 389
NspI RCATGY 1 cut(s) 409
PciI ACATGT 1 cut(s) 405
PctI GAATGC 1 cut(s) 73
PfeI GAWTC 2 cut(s) 96, 238
PfoI TCCNGGA 1 cut(s) 247
PscI ACATGT 1 cut(s) 405
Psp6I CCWGG 2 cut(s) 47, 247
PspGI CCWGG 2 cut(s) 47, 247
PspPI GGNCC 1 cut(s) 429
RsaI GTAC 1 cut(s) 108
RsaNI GTAC 1 cut(s) 107
RseI CAYNNNNRTG 2 cut(s) 78, 264
Sau96I GGNCC 1 cut(s) 429
ScrFI CCNGG 2 cut(s) 49, 249
SetI ASST 6 cut(s) 53, 92, 286, 337, 381, 445
SfaNI GCATC 2 cut(s) 71, 330
SfcI CTRYAG 1 cut(s) 467
SmiMI CAYNNNNRTG 2 cut(s) 78, 264
SmlI CTYRAG 1 cut(s) 7
SmoI CTYRAG 1 cut(s) 7
Sse9I AATT 1 cut(s) 397
SspMI CTAG 1 cut(s) 305
StyD4I CCNGG 2 cut(s) 47, 247
TaaI ACNGT 3 cut(s) 16, 42, 311
TaqI TCGA 1 cut(s) 20
TasI AATT 1 cut(s) 397
TfiI GAWTC 2 cut(s) 96, 238
TscAI CASTG 1 cut(s) 21
TseFI GTSAC 1 cut(s) 389
Tsp45I GTSAC 1 cut(s) 389
TspDTI ATGAA 2 cut(s) 191, 269
TspRI CASTG 1 cut(s) 21
XceI RCATGY 1 cut(s) 409
XspI CTAG 1 cut(s) 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.