Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0002791

Physical Location & Seq

Genomic Coordinates Reverse (-)

18309737 .. 18309954

Gene Structure 218 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ37258

Sequence Viewer

CDS Protein Promoter (2k)

Length: 135 bp

ATGCATAATGAAGGAGACATTTGGAATATGTATGAGACATTTGCTTCAATGATTGCAGATGCAGGTTTCCAGAAGGTTGAGTATGAAAATCTAGTTGGAGGAGTGGTAGCGATTCATTCAGGGTTGAAAATTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00130 ko01100 ko01110 map00130 map01100 map01110

Pfam Domains

Protein Families

Ubie_methyltran

Protein Analysis

44

Amino Acids

4.89

Weight (kDa)

4.63

Isoelectric Point (pI)

31.7

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ubie_methyltran	PF01209	11 - 43	3.9e-09	ubiE/COQ5 methyltransferase family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002791)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G57300 AT5G57300 AT5G57300 AT5G57300
fragaria_vesca	FvH4_4g07660 FvH4_4g07660 FvH4_4g07660 FvH4_4g07660 FvH4_4g07660 FvH4_4g07660 FvH4_4g07660 FvH4_4g07660
malus_domestica	MD03G1035800.v1.1 MD03G1036000.v1.1 MD13G1245000.v1.1 MD16G1253300.v1.1
prunus_persica	Prupe.1G079700_v2.0.a1 Prupe.1G079700_v2.0.a1
pyrus_communis	pycom13g21600
rosa_chinensis	RchiOBHm_Chr4g0400331 RchiOBHm_Chr4g0400411 RchiOBHm_Chr4g0400471 RchiOBHm_Chr4g0400591 RchiOBHm_Chr4g0400601 RchiOBHm_Chr4g0400651 RchiOBHm_Chr4g0400661
rosa_laevigata	RLG00000009189
rosa_multiflora	Rmu_sc0003957.1_g000001
rosa_roxburghii	Rroxscaffold_5G00345430
rosa_rugosa	Rorug04G0024900 Rorug04G0025000
rosa_samantha	Rh4AG101200 Rh4AG101300 Rh4AG102600 Rh4BG097900 Rh4CG110900 Rh4DG094600 Rh7BG256500
rosa_wichuraiana	Rw4G008310

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	53
AcsI	RAATTY	1 cut(s)	129
AgsI	TTSAA	2 cut(s)	48, 127
AjuI	GAANNNNNNNTTGG	2 cut(s)	78, 110
Alw26I	GTCTC	2 cut(s)	9, 29
ApoI	RAATTY	1 cut(s)	129
BcoDI	GTCTC	2 cut(s)	9, 29
BfaI	CTAG	1 cut(s)	92
BfuAI	ACCTGC	1 cut(s)	53
BmsI	GCATC	1 cut(s)	49
BsaXI	ACNNNNNCTCC	2 cut(s)	90, 120
BseRI	GAGGAG	1 cut(s)	114
BsmAI	GTCTC	2 cut(s)	9, 29
BspMI	ACCTGC	1 cut(s)	53
BstMAI	GTCTC	2 cut(s)	9, 29
BveI	ACCTGC	1 cut(s)	53
EcoT22I	ATGCAT	1 cut(s)	6
FaiI	YATR	4 cut(s)	6, 29, 33, 84
FspBI	CTAG	1 cut(s)	92
FspEI	CC	9 cut(s)	7, 48, 59, 81, 83, 84, 89, 105, 106
HinfI	GANTC	1 cut(s)	112
Hpy188III	TCNNGA	1 cut(s)	70
HpyAV	CCTTC	2 cut(s)	5, 67
HpyCH4V	TGCA	3 cut(s)	4, 56, 62
LpnPI	CCDG	3 cut(s)	48, 83, 105
LweI	GCATC	1 cut(s)	49
MaeI	CTAG	1 cut(s)	92
MluCI	AATT	1 cut(s)	129
MmeI	TCCRAC	1 cut(s)	76
MnlI	CCTC	1 cut(s)	92
Mph1103I	ATGCAT	1 cut(s)	6
NsiI	ATGCAT	1 cut(s)	6
PfeI	GAWTC	1 cut(s)	112
SetI	ASST	2 cut(s)	67, 78
SfaNI	GCATC	1 cut(s)	49
SgeI	CNNG	3 cut(s)	75, 82, 104
Sse9I	AATT	1 cut(s)	129
SspMI	CTAG	1 cut(s)	92
TasI	AATT	1 cut(s)	129
TfiI	GAWTC	1 cut(s)	112
TspDTI	ATGAA	3 cut(s)	24, 99, 104
XapI	RAATTY	1 cut(s)	129
XspI	CTAG	1 cut(s)	92
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.