RchiOBHm_Chr3g0464201

ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
11366846 .. 11367556
711 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 273 bp
ATGCAGAAGCACGGTTATATTGGAGAGTTTGAGTATGTTGATGACCACAGATCTGGAAAGATTGTGGCTGAACTCAATGGGAGGCTGAACAAGTGTGGGGTTATCAGTCCTCGCTTTGATGTTGGTGTCAAGGAGATTGAAGGCTGGACGGCTAGACTTCTTCCGTCAAGACAGTTTGGATACATTGTGTTGACTACATCTACTGGAATCATGGATCACGAGGAAGCTAGGAGAAAGAATGTTGGTGGCAAGGTTCTCGGTTTCTTTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

10.19

Weight (kDa)

8.82

Isoelectric Point (pI)

34.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8 PF00410 1 - 90 8e-12 Ribosomal protein S8
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 222
AgsI TTSAA 1 cut(s) 140
AluBI AGCT 1 cut(s) 227
AluI AGCT 1 cut(s) 227
AlwI GGATC 1 cut(s) 222
BauI CACGAG 1 cut(s) 218
BceAI ACGGC 1 cut(s) 165
BcgI CGANNNNNNTGC 2 cut(s) 238, 272
BciVI GTATCC 1 cut(s) 173
BfaI CTAG 2 cut(s) 153, 228
BfuI GTATCC 1 cut(s) 173
BglII AGATCT 1 cut(s) 50
Bse1I ACTGG 1 cut(s) 208
BseNI ACTGG 1 cut(s) 208
Bsp143I GATC 2 cut(s) 50, 214
BspPI GGATC 1 cut(s) 222
BsrI ACTGG 1 cut(s) 208
BssMI GATC 2 cut(s) 50, 214
BssSI CACGAG 1 cut(s) 218
Bst2BI CACGAG 1 cut(s) 218
Bst4CI ACNGT 2 cut(s) 14, 174
BstKTI GATC 2 cut(s) 53, 217
BstMBI GATC 2 cut(s) 50, 214
BstX2I RGATCY 1 cut(s) 50
BstXI CCANNNNNNTGG 1 cut(s) 53
BstYI RGATCY 1 cut(s) 50
BsuI GTATCC 1 cut(s) 173
CviAII CATG 1 cut(s) 211
CviJI RGCY 5 cut(s) 68, 85, 144, 152, 227
CviKI_1 RGCY 5 cut(s) 68, 85, 144, 152, 227
DpnI GATC 2 cut(s) 52, 216
DpnII GATC 2 cut(s) 50, 214
FaeI CATG 1 cut(s) 214
FaiI YATR 3 cut(s) 18, 36, 212
FatI CATG 1 cut(s) 210
FspBI CTAG 2 cut(s) 153, 228
Hin1II CATG 1 cut(s) 214
HincII GTYRAC 1 cut(s) 192
HindII GTYRAC 1 cut(s) 192
HinfI GANTC 1 cut(s) 207
Hpy166II GTNNAC 1 cut(s) 192
Hpy188III TCNNGA 3 cut(s) 54, 168, 218
Hpy8I GTNNAC 1 cut(s) 192
HpyAV CCTTC 1 cut(s) 134
HpyCH4III ACNGT 2 cut(s) 14, 174
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 1 cut(s) 214
Kzo9I GATC 2 cut(s) 50, 214
LpnPI CCDG 3 cut(s) 39, 130, 189
MaeI CTAG 2 cut(s) 153, 228
MalI GATC 2 cut(s) 52, 216
MboI GATC 2 cut(s) 50, 214
MboII GAAGA 1 cut(s) 152
MflI RGATCY 1 cut(s) 50
MnlI CCTC 3 cut(s) 75, 120, 214
NdeII GATC 2 cut(s) 50, 214
NlaIII CATG 1 cut(s) 214
PfeI GAWTC 1 cut(s) 207
PsuI RGATCY 1 cut(s) 50
Sau3AI GATC 2 cut(s) 50, 214
SetI ASST 2 cut(s) 229, 255
SspMI CTAG 2 cut(s) 153, 228
TaaI ACNGT 2 cut(s) 14, 174
TfiI GAWTC 1 cut(s) 207
TspGWI ACGGA 1 cut(s) 153
XspI CTAG 2 cut(s) 153, 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.