RchiOBHm_Chr3g0474831

Regulates membrane-cell wall junctions and localized cell wall deposition. Required for establishment of the Casparian strip membrane domain (CSD) and the subsequent formation of Casparian strips, a cell wall modification of the root endodermis that determines an apoplastic barrier between the intraorganismal apoplasm and the extraorganismal apoplasm and prevents lateral diffusion (By similarity)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
20585264 .. 20586290
1027 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 600 bp
ATGAAGAGTGAAGCAACCGCCATTGATGTTCCTGAGGCAAGCGGAGCAACCAAAGGAAAAGCACCTATTTTGACGGTTCCTAGGCAAGAGAAGGGAGGAATGAACAGAGGGCTTGGGATTATCGACTTGGTCTTAAGGATAGGTGCAATGGTGGCTGCTCTAGCTTCTGCTGCCACCATGGGGACTAGTGATCAGAACCTTCCTTTCTTCACTCAGTTCTTCCAGTTTGAAGCTAGCTATGATGACATGCCCAGTTTCGAGTTTTTCTTGATAGCAATGTCACTTGTAGCTGGCTACCTGGTGCTATCTATCCCCTTCTCCATAGTAGCCATTGTTCGCCCCCATGCTGCTGGACCAAGGCTCTTGCTCCTCATCATGGACACTGTGGCGCTTACTCTAGCGACAGCTGCTGCTGCGGCTGCAACATCCATAGTCTACTTAGCACACAATGGCAATGCCAGCTCGAATTGGCTCGCCATTTGCAACCAGTTTGGTGATTTCTGCCAGCAAATCAGTGCGGCTGTGGTCGCAGCCTTTATGACTGTTGTTACCTTCATGTTCTTGATTCTGCTCTCTGCTTTGGCTCTCCGAAAGCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

199

Amino Acids

21.05

Weight (kDa)

6.26

Isoelectric Point (pI)

23.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CASP_dom PF04535 36 - 183 1.8e-46 Casparian strip membrane protein domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 435
AciI CCGC 4 cut(s) 18, 42, 416, 518
AfiI CCNNNNNNNGG 2 cut(s) 180, 376
AflII CTTAAG 1 cut(s) 133
AgsI TTSAA 1 cut(s) 230
AhlI ACTAGT 1 cut(s) 185
AjnI CCWGG 1 cut(s) 297
AluBI AGCT 6 cut(s) 164, 233, 237, 290, 407, 462
AluI AGCT 6 cut(s) 164, 233, 237, 290, 407, 462
AlwNI CAGNNNCTG 1 cut(s) 410
ApeKI GCWGC 8 cut(s) 155, 170, 347, 407, 410, 413, 419, 530
AspA2I CCTAGG 1 cut(s) 80
AspLEI GCGC 1 cut(s) 391
AspS9I GGNCC 1 cut(s) 353
AsuHPI GGTGA 1 cut(s) 506
AsuNHI GCTAGC 1 cut(s) 233
AvaII GGWCC 1 cut(s) 353
AvrII CCTAGG 1 cut(s) 80
AxyI CCTNAGG 1 cut(s) 33
BbvI GCAGC 8 cut(s) 142, 157, 334, 394, 397, 400, 406, 542
BciT130I CCWGG 1 cut(s) 299
BclI TGATCA 1 cut(s) 190
BcuI ACTAGT 1 cut(s) 185
BfaI CTAG 5 cut(s) 81, 161, 186, 234, 398
BfoI RGCGCY 1 cut(s) 392
BfrI CTTAAG 1 cut(s) 133
BlnI CCTAGG 1 cut(s) 80
Bme1390I CCNGG 1 cut(s) 299
Bme18I GGWCC 1 cut(s) 353
BmgT120I GGNCC 1 cut(s) 353
BmiI GGNNCC 1 cut(s) 78
BmrFI CCNGG 1 cut(s) 299
BmrI ACTGGG 1 cut(s) 246
BmtI GCTAGC 1 cut(s) 237
BmuI ACTGGG 1 cut(s) 246
BsaJI CCNNGG 3 cut(s) 80, 177, 356
Bsc4I CCNNNNNNNGG 2 cut(s) 180, 376
Bse1I ACTGG 3 cut(s) 223, 252, 487
Bse21I CCTNAGG 1 cut(s) 33
Bse3DI GCAATG 3 cut(s) 153, 282, 460
BseBI CCWGG 1 cut(s) 299
BseDI CCNNGG 3 cut(s) 80, 177, 356
BseGI GGATG 1 cut(s) 425
BseLI CCNNNNNNNGG 2 cut(s) 180, 376
BseMI GCAATG 3 cut(s) 153, 282, 460
BseMII CTCAG 2 cut(s) 24, 227
BseNI ACTGG 3 cut(s) 223, 252, 487
BseRI GAGGAG 1 cut(s) 359
BseXI GCAGC 8 cut(s) 142, 157, 334, 394, 397, 400, 406, 542
BslFI GGGAC 1 cut(s) 196
BslI CCNNNNNNNGG 2 cut(s) 180, 376
BsmFI GGGAC 1 cut(s) 196
Bsp143I GATC 1 cut(s) 190
Bsp19I CCATGG 1 cut(s) 177
BspACI CCGC 4 cut(s) 18, 42, 416, 518
BspCNI CTCAG 2 cut(s) 25, 226
BspLI GGNNCC 1 cut(s) 78
BspOI GCTAGC 1 cut(s) 237
BspTI CTTAAG 1 cut(s) 133
BsrDI GCAATG 3 cut(s) 153, 282, 460
BsrI ACTGG 3 cut(s) 223, 252, 487
BssECI CCNNGG 3 cut(s) 80, 177, 356
BssMI GATC 1 cut(s) 190
BssT1I CCWWGG 3 cut(s) 80, 177, 356
Bst2UI CCWGG 1 cut(s) 299
Bst4CI ACNGT 3 cut(s) 76, 385, 544
BstAFI CTTAAG 1 cut(s) 133
BstC8I GCNNGC 6 cut(s) 40, 235, 292, 460, 474, 506
BstDEI CTNAG 3 cut(s) 33, 213, 439
BstDSI CCRYGG 1 cut(s) 177
BstF5I GGATG 1 cut(s) 425
BstH2I RGCGCY 1 cut(s) 392
BstHHI GCGC 1 cut(s) 391
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstNI CCWGG 1 cut(s) 299
BstNSI RCATGY 1 cut(s) 250
BstSCI CCNGG 1 cut(s) 297
BstV1I GCAGC 8 cut(s) 142, 157, 334, 394, 397, 400, 406, 542
BstXI CCANNNNNNTGG 1 cut(s) 350
Bsu36I CCTNAGG 1 cut(s) 33
BtgI CCRYGG 1 cut(s) 177
BtsCI GGATG 1 cut(s) 425
BtsIMutI CAGTG 2 cut(s) 381, 520
Cac8I GCNNGC 6 cut(s) 40, 235, 292, 460, 474, 506
CaiI CAGNNNCTG 1 cut(s) 410
CfoI GCGC 1 cut(s) 391
Cfr13I GGNCC 1 cut(s) 353
CsiI ACCWGGT 1 cut(s) 297
CviAII CATG 5 cut(s) 178, 247, 344, 376, 556
DdeI CTNAG 3 cut(s) 33, 213, 439
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eco130I CCWWGG 3 cut(s) 80, 177, 356
Eco47I GGWCC 1 cut(s) 353
Eco81I CCTNAGG 1 cut(s) 33
EcoRII CCWGG 1 cut(s) 297
EcoT14I CCWWGG 3 cut(s) 80, 177, 356
ErhI CCWWGG 3 cut(s) 80, 177, 356
FaeI CATG 5 cut(s) 181, 250, 347, 379, 559
FaiI YATR 9 cut(s) 179, 240, 248, 323, 345, 377, 431, 539, 557
FaqI GGGAC 1 cut(s) 196
FatI CATG 5 cut(s) 177, 246, 343, 375, 555
FbaI TGATCA 1 cut(s) 190
FblI GTMKAC 1 cut(s) 435
FokI GGATG 1 cut(s) 412
FspBI CTAG 5 cut(s) 81, 161, 186, 234, 398
GlaI GCGC 1 cut(s) 390
HaeII RGCGCY 1 cut(s) 392
HhaI GCGC 1 cut(s) 391
Hin1II CATG 5 cut(s) 181, 250, 347, 379, 559
Hin6I GCGC 1 cut(s) 389
HinP1I GCGC 1 cut(s) 389
HinfI GANTC 1 cut(s) 565
HphI GGTGA 1 cut(s) 506
Hpy166II GTNNAC 1 cut(s) 436
Hpy188I TCNGA 2 cut(s) 195, 590
Hpy188III TCNNGA 3 cut(s) 32, 268, 562
Hpy8I GTNNAC 1 cut(s) 436
HpyAV CCTTC 4 cut(s) 85, 209, 325, 562
HpyCH4III ACNGT 3 cut(s) 76, 385, 544
HpyCH4V TGCA 3 cut(s) 146, 422, 483
HpyF3I CTNAG 3 cut(s) 33, 213, 439
Hsp92II CATG 5 cut(s) 181, 250, 347, 379, 559
HspAI GCGC 1 cut(s) 389
Ksp22I TGATCA 1 cut(s) 190
Kzo9I GATC 1 cut(s) 190
LmnI GCTCC 2 cut(s) 44, 372
Lsp1109I GCAGC 8 cut(s) 142, 157, 334, 394, 397, 400, 406, 542
MabI ACCWGGT 1 cut(s) 297
MaeI CTAG 5 cut(s) 81, 161, 186, 234, 398
MaeIII GTNAC 2 cut(s) 279, 547
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 3 cut(s) 16, 199, 211
MluCI AATT 1 cut(s) 466
MnlI CCTC 4 cut(s) 28, 89, 101, 380
MseI TTAA 1 cut(s) 134
MspA1I CMGCKG 1 cut(s) 407
MspCI CTTAAG 1 cut(s) 133
MspR9I CCNGG 1 cut(s) 299
MvaI CCWGG 1 cut(s) 299
NcoI CCATGG 1 cut(s) 177
NdeII GATC 1 cut(s) 190
NheI GCTAGC 1 cut(s) 233
NlaIII CATG 5 cut(s) 181, 250, 347, 379, 559
NlaIV GGNNCC 1 cut(s) 78
NmuCI GTSAC 1 cut(s) 279
NspI RCATGY 1 cut(s) 250
PfeI GAWTC 1 cut(s) 565
PflFI GACNNNGTC 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 297
PspGI CCWGG 1 cut(s) 297
PspN4I GGNNCC 1 cut(s) 78
PspPI GGNCC 1 cut(s) 353
PsrI GAACNNNNNNTAC 2 cut(s) 318, 350
PstNI CAGNNNCTG 1 cut(s) 410
PsyI GACNNNGTC 1 cut(s) 128
PvuII CAGCTG 1 cut(s) 407
SaqAI TTAA 1 cut(s) 134
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 1 cut(s) 353
ScrFI CCNGG 1 cut(s) 299
SexAI ACCWGGT 1 cut(s) 297
SinI GGWCC 1 cut(s) 353
SmlI CTYRAG 1 cut(s) 133
SmoI CTYRAG 1 cut(s) 133
SpeI ACTAGT 1 cut(s) 185
Sse9I AATT 1 cut(s) 466
SsiI CCGC 4 cut(s) 18, 42, 416, 518
SspMI CTAG 5 cut(s) 81, 161, 186, 234, 398
StyD4I CCNGG 1 cut(s) 297
StyI CCWWGG 3 cut(s) 80, 177, 356
TaaI ACNGT 3 cut(s) 76, 385, 544
TaqI TCGA 3 cut(s) 123, 258, 464
TasI AATT 1 cut(s) 466
TauI GCSGC 2 cut(s) 419, 521
TfiI GAWTC 1 cut(s) 565
Tru1I TTAA 1 cut(s) 134
Tru9I TTAA 1 cut(s) 134
TscAI CASTG 2 cut(s) 388, 520
TseFI GTSAC 1 cut(s) 279
TseI GCWGC 8 cut(s) 155, 170, 347, 407, 410, 413, 419, 530
Tsp45I GTSAC 1 cut(s) 279
TspDTI ATGAA 3 cut(s) 17, 116, 544
TspRI CASTG 2 cut(s) 388, 520
Tth111I GACNNNGTC 1 cut(s) 128
Vha464I CTTAAG 1 cut(s) 133
VpaK11BI GGWCC 1 cut(s) 353
XceI RCATGY 1 cut(s) 250
XmaJI CCTAGG 1 cut(s) 80
XmiI GTMKAC 1 cut(s) 435
XspI CTAG 5 cut(s) 81, 161, 186, 234, 398
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.