RchiOBHm_Chr3g0484611

DNA polymerase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
31007496 .. 31008717
1222 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 255 bp
ATGCAAGATCATGTAAGTGACATACATGCCTCAGTTTCTTTCAATACAGATTTCATTCCATGCGTTATTCAAGAGATAGTGACTACTGGAAAGCTATTCAAGTTGGACCACTTTGAAACAGTTGAAAAGGTAAAAACAATAAGCTTATTCGAGGAAATATGGGGTGTAGGTCCAACTACTGCACTAAAATTATTTGAGAAAGGACATCGCACATTAGATGATTTGAAGAATGAAGATTCATTGACACATTCATAG

Protein Analysis

84

Amino Acids

9.53

Weight (kDa)

5.16

Isoelectric Point (pI)

7.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DNA_pol_lambd_f PF10391 49 - 83 6.9e-13 Fingers domain of DNA polymerase lambda
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 6 cut(s) 43, 71, 100, 116, 125, 226
AluBI AGCT 2 cut(s) 94, 144
AluI AGCT 2 cut(s) 94, 144
AspS9I GGNCC 2 cut(s) 106, 170
AvaII GGWCC 2 cut(s) 106, 170
Bme18I GGWCC 2 cut(s) 106, 170
BmgT120I GGNCC 2 cut(s) 106, 170
Bse1I ACTGG 1 cut(s) 91
BseMII CTCAG 1 cut(s) 45
BseNI ACTGG 1 cut(s) 91
BsgI GTGCAG 1 cut(s) 165
Bsp143I GATC 1 cut(s) 7
BspCNI CTCAG 1 cut(s) 44
BsrI ACTGG 1 cut(s) 91
BssMI GATC 1 cut(s) 7
Bst4CI ACNGT 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 31
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BstNSI RCATGY 1 cut(s) 29
BtgZI GCGATG 1 cut(s) 191
Cfr13I GGNCC 2 cut(s) 106, 170
CviAII CATG 3 cut(s) 11, 26, 60
CviJI RGCY 2 cut(s) 94, 144
CviKI_1 RGCY 2 cut(s) 94, 144
DdeI CTNAG 1 cut(s) 31
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eco47I GGWCC 2 cut(s) 106, 170
FaeI CATG 3 cut(s) 14, 29, 63
FaiI YATR 6 cut(s) 12, 23, 27, 61, 160, 253
FatI CATG 3 cut(s) 10, 25, 59
Hin1II CATG 3 cut(s) 14, 29, 63
HindIII AAGCTT 1 cut(s) 142
HinfI GANTC 1 cut(s) 236
Hpy188III TCNNGA 1 cut(s) 71
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4V TGCA 2 cut(s) 4, 182
HpyF3I CTNAG 1 cut(s) 31
Hsp92II CATG 3 cut(s) 14, 29, 63
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 1 cut(s) 72
MaeIII GTNAC 2 cut(s) 17, 79
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MboII GAAGA 2 cut(s) 238, 245
MluCI AATT 1 cut(s) 188
MmeI TCCRAC 2 cut(s) 84, 197
MnlI CCTC 2 cut(s) 40, 145
MslI CAYNNNNRTG 1 cut(s) 15
NdeII GATC 1 cut(s) 7
NlaIII CATG 3 cut(s) 14, 29, 63
NmuCI GTSAC 2 cut(s) 17, 79
NspI RCATGY 1 cut(s) 29
PfeI GAWTC 1 cut(s) 236
PspPI GGNCC 2 cut(s) 106, 170
RseI CAYNNNNRTG 1 cut(s) 15
Sau3AI GATC 1 cut(s) 7
Sau96I GGNCC 2 cut(s) 106, 170
SetI ASST 4 cut(s) 96, 132, 146, 172
SgeI CNNG 8 cut(s) 17, 23, 38, 72, 83, 99, 112, 163
SinI GGWCC 2 cut(s) 106, 170
SmiMI CAYNNNNRTG 1 cut(s) 15
Sse9I AATT 1 cut(s) 188
TaaI ACNGT 1 cut(s) 121
TaqI TCGA 1 cut(s) 150
TasI AATT 1 cut(s) 188
TfiI GAWTC 1 cut(s) 236
TseFI GTSAC 2 cut(s) 17, 79
Tsp45I GTSAC 2 cut(s) 17, 79
TspDTI ATGAA 4 cut(s) 43, 228, 240, 246
VpaK11BI GGWCC 2 cut(s) 106, 170
XceI RCATGY 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.