RchiOBHm_Chr2g0104581

Carrier of the growing fatty acid chain in fatty acid biosynthesis

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
15912990 .. 15918411
5422 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 132 bp
ATGGTACGCAGCAGCAGCGTTTCTAGTTTGAAATCGGTTTCTTTTTCCATTACTGGGAATCGCTTCCCATCTCTAACTTCAAGACCTGGACCTTTTCAAGTTTCCTATTCGAGAACACCATCAATTATTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

43

Amino Acids

4.65

Weight (kDa)

12.0

Isoelectric Point (pI)

57.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 6
AfiI CCNNNNNNNGG 1 cut(s) 54
AgsI TTSAA 3 cut(s) 31, 81, 98
AjnI CCWGG 1 cut(s) 85
ApeKI GCWGC 3 cut(s) 9, 12, 15
Asp700I GAANNNNTTC 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 89
AvaII GGWCC 1 cut(s) 89
BbvI GCAGC 3 cut(s) 21, 24, 27
BccI CCATC 2 cut(s) 76, 127
BciT130I CCWGG 1 cut(s) 87
BfaI CTAG 1 cut(s) 24
BisI GCNGC 3 cut(s) 10, 13, 16
BlsI GCNGC 3 cut(s) 11, 14, 17
Bme1390I CCNGG 1 cut(s) 87
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmrFI CCNGG 1 cut(s) 87
BmrI ACTGGG 1 cut(s) 63
BmuI ACTGGG 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 54
Bse1I ACTGG 1 cut(s) 58
BseBI CCWGG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 58
BseXI GCAGC 3 cut(s) 21, 24, 27
BslI CCNNNNNNNGG 1 cut(s) 54
BsrI ACTGG 1 cut(s) 58
Bst2UI CCWGG 1 cut(s) 87
BstMWI GCNNNNNNNGC 1 cut(s) 15
BstNI CCWGG 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 85
BstV1I GCAGC 3 cut(s) 21, 24, 27
Cfr13I GGNCC 1 cut(s) 89
Csp6I GTAC 1 cut(s) 5
CviQI GTAC 1 cut(s) 5
Eco47I GGWCC 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 85
Fnu4HI GCNGC 3 cut(s) 10, 13, 16
Fsp4HI GCNGC 3 cut(s) 10, 13, 16
FspBI CTAG 1 cut(s) 24
GluI GCNGC 3 cut(s) 10, 13, 16
HinfI GANTC 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 81, 111
HpyF10VI GCNNNNNNNGC 1 cut(s) 15
LpnPI CCDG 3 cut(s) 39, 72, 99
Lsp1109I GCAGC 3 cut(s) 21, 24, 27
MaeI CTAG 1 cut(s) 24
MluCI AATT 1 cut(s) 123
MroXI GAANNNNTTC 1 cut(s) 62
MspR9I CCNGG 1 cut(s) 87
MvaI CCWGG 1 cut(s) 87
MwoI GCNNNNNNNGC 1 cut(s) 15
PdmI GAANNNNTTC 1 cut(s) 62
PfeI GAWTC 1 cut(s) 58
PkrI GCNGC 3 cut(s) 11, 14, 17
Psp6I CCWGG 1 cut(s) 85
PspGI CCWGG 1 cut(s) 85
PspPI GGNCC 1 cut(s) 89
RsaI GTAC 1 cut(s) 6
RsaNI GTAC 1 cut(s) 5
SatI GCNGC 3 cut(s) 10, 13, 16
Sau96I GGNCC 1 cut(s) 89
ScrFI CCNGG 1 cut(s) 87
SetI ASST 2 cut(s) 88, 94
SgeI CNNG 7 cut(s) 36, 66, 93, 98, 99, 110, 123
SinI GGWCC 1 cut(s) 89
Sse9I AATT 1 cut(s) 123
SspMI CTAG 1 cut(s) 24
StyD4I CCNGG 1 cut(s) 85
TaqI TCGA 1 cut(s) 110
TasI AATT 1 cut(s) 123
TfiI GAWTC 1 cut(s) 58
TseI GCWGC 3 cut(s) 9, 12, 15
VpaK11BI GGWCC 1 cut(s) 89
XmnI GAANNNNTTC 1 cut(s) 62
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.