RchiOBHm_Chr1g0344781

Outer envelope protein 61

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
37086331 .. 37086810
480 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 480 bp
ATGCATGCACGTGTTGATGCCGAAGTCAGTTACAAATTGAATGCATCTCAGATGCTCAAGAATCAGGGAAATGAACTTCACAGCCAGGGAAAGTTCAACGATGCCATGCAGAAGTACGTACTTGCAAAGACAAATTTGAATGGCCTTCCATCCTCTAAAGGAAGATCACTACTGATGGCATGCTCACTCAATTTAATGTCATGTTACTTGAAAACAAGGCAGTATTATGAATGTATAAAAGAAGGTTCTGAGGTACTGGCATGTGATGCACAGAATGTGAAAGCTCTCTATCGGAGAGGTCAAGCATGTAAAGAATGTGGTCAATTGGAAGATGCTGTCTATGACCTGAGCATGGCACATGAAGTTTCCCCTGATGATGAAACTATTGCGGATGTTCTAAGGGAAGCTAAGGAAAACTTCGGTACAGAGGGCAGTGTGTCAGCAGTTCTGCACCAAGAAGACTGGTTATTGAAGAAATAA

Protein Analysis

159

Amino Acids

17.77

Weight (kDa)

5.82

Isoelectric Point (pI)

47.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 389
AcsI RAATTY 1 cut(s) 133
AcvI CACGTG 1 cut(s) 11
AfaI GTAC 4 cut(s) 116, 120, 255, 424
AfiI CCNNNNNNNGG 1 cut(s) 352
AflIII ACRYGT 1 cut(s) 10
AgsI TTSAA 5 cut(s) 40, 97, 139, 211, 472
AjnI CCWGG 1 cut(s) 84
AluBI AGCT 2 cut(s) 284, 407
AluI AGCT 2 cut(s) 284, 407
AoxI GGCC 1 cut(s) 142
ApoI RAATTY 1 cut(s) 133
BbrPI CACGTG 1 cut(s) 11
BbsI GAAGAC 1 cut(s) 465
BccI CCATC 2 cut(s) 157, 169
BciT130I CCWGG 1 cut(s) 86
Bme1390I CCNGG 1 cut(s) 86
BmrFI CCNGG 1 cut(s) 86
BmsI GCATC 6 cut(s) 7, 42, 53, 91, 256, 322
BpiI GAAGAC 1 cut(s) 465
Bpu10I CCTNAGC 2 cut(s) 347, 408
BpuEI CTTGAG 1 cut(s) 41
BsaAI YACGTR 2 cut(s) 11, 118
BsaJI CCNNGG 1 cut(s) 85
Bsc4I CCNNNNNNNGG 1 cut(s) 352
Bse1I ACTGG 2 cut(s) 261, 467
BseBI CCWGG 1 cut(s) 86
BseDI CCNNGG 1 cut(s) 85
BseGI GGATG 2 cut(s) 149, 397
BseLI CCNNNNNNNGG 1 cut(s) 352
BseMII CTCAG 3 cut(s) 62, 240, 338
BseNI ACTGG 2 cut(s) 261, 467
BsgI GTGCAG 1 cut(s) 434
BshFI GGCC 1 cut(s) 144
BslI CCNNNNNNNGG 1 cut(s) 352
BsmI GAATGC 1 cut(s) 46
BsnI GGCC 1 cut(s) 144
Bsp143I GATC 1 cut(s) 164
BspACI CCGC 1 cut(s) 389
BspANI GGCC 1 cut(s) 144
BspCNI CTCAG 3 cut(s) 61, 241, 339
BsrI ACTGG 2 cut(s) 261, 467
BssECI CCNNGG 1 cut(s) 85
BssMI GATC 1 cut(s) 164
Bst2UI CCWGG 1 cut(s) 86
BstAPI GCANNNNNTGC 1 cut(s) 266
BstBAI YACGTR 2 cut(s) 11, 118
BstC8I GCNNGC 2 cut(s) 6, 181
BstDEI CTNAG 5 cut(s) 48, 249, 347, 398, 408
BstF5I GGATG 2 cut(s) 149, 397
BstKTI GATC 1 cut(s) 167
BstMBI GATC 1 cut(s) 164
BstMWI GCNNNNNNNGC 1 cut(s) 266
BstNI CCWGG 1 cut(s) 86
BstNSI RCATGY 4 cut(s) 8, 183, 264, 309
BstSCI CCNGG 1 cut(s) 84
BstSNI TACGTA 1 cut(s) 118
BstV2I GAAGAC 1 cut(s) 465
BsuRI GGCC 1 cut(s) 144
BtsCI GGATG 2 cut(s) 149, 397
BtsI GCAGTG 1 cut(s) 439
BtsIMutI CAGTG 1 cut(s) 439
Cac8I GCNNGC 2 cut(s) 6, 181
Csp6I GTAC 4 cut(s) 115, 119, 254, 423
CviAII CATG 8 cut(s) 5, 106, 180, 201, 261, 306, 352, 359
CviJI RGCY 4 cut(s) 84, 144, 284, 407
CviKI_1 RGCY 4 cut(s) 84, 144, 284, 407
CviQI GTAC 4 cut(s) 115, 119, 254, 423
DdeI CTNAG 5 cut(s) 48, 249, 347, 398, 408
DpnI GATC 1 cut(s) 166
DpnII GATC 1 cut(s) 164
Eco105I TACGTA 1 cut(s) 118
Eco72I CACGTG 1 cut(s) 11
EcoRII CCWGG 1 cut(s) 84
EcoT22I ATGCAT 2 cut(s) 6, 46
FaeI CATG 8 cut(s) 8, 109, 183, 204, 264, 309, 355, 362
FalI AAGNNNNNCTT 2 cut(s) 401, 433
FatI CATG 8 cut(s) 4, 105, 179, 200, 260, 305, 351, 358
FokI GGATG 2 cut(s) 136, 404
HaeIII GGCC 1 cut(s) 144
Hin1II CATG 8 cut(s) 8, 109, 183, 204, 264, 309, 355, 362
HinfI GANTC 1 cut(s) 61
Hpy188I TCNGA 3 cut(s) 51, 250, 294
Hpy188III TCNNGA 1 cut(s) 58
HpyAV CCTTC 2 cut(s) 155, 236
HpyCH4IV ACGT 2 cut(s) 10, 117
HpyCH4V TGCA 7 cut(s) 4, 8, 44, 109, 125, 269, 451
HpyF10VI GCNNNNNNNGC 1 cut(s) 266
HpyF3I CTNAG 5 cut(s) 48, 249, 347, 398, 408
HpySE526I ACGT 2 cut(s) 10, 117
Hsp92II CATG 8 cut(s) 8, 109, 183, 204, 264, 309, 355, 362
Kzo9I GATC 1 cut(s) 164
LpnPI CCDG 7 cut(s) 50, 71, 98, 242, 359, 384, 448
LweI GCATC 6 cut(s) 7, 42, 53, 91, 256, 322
MaeII ACGT 2 cut(s) 10, 117
MaeIII GTNAC 2 cut(s) 29, 203
MalI GATC 1 cut(s) 166
MboI GATC 1 cut(s) 164
MboII GAAGA 3 cut(s) 174, 341, 470
MfeI CAATTG 1 cut(s) 323
MluCI AATT 4 cut(s) 35, 133, 190, 323
MnlI CCTC 4 cut(s) 163, 244, 290, 421
Mph1103I ATGCAT 2 cut(s) 6, 46
MseI TTAA 1 cut(s) 194
MslI CAYNNNNRTG 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 86
MunI CAATTG 1 cut(s) 323
Mva1269I GAATGC 1 cut(s) 46
MvaI CCWGG 1 cut(s) 86
MwoI GCNNNNNNNGC 1 cut(s) 266
NdeII GATC 1 cut(s) 164
NlaIII CATG 8 cut(s) 8, 109, 183, 204, 264, 309, 355, 362
NsiI ATGCAT 2 cut(s) 6, 46
NspI RCATGY 4 cut(s) 8, 183, 264, 309
PaeI GCATGC 2 cut(s) 8, 183
PctI GAATGC 1 cut(s) 46
PfeI GAWTC 1 cut(s) 61
PmaCI CACGTG 1 cut(s) 11
PmlI CACGTG 1 cut(s) 11
Ppu21I YACGTR 2 cut(s) 11, 118
Psp6I CCWGG 1 cut(s) 84
PspCI CACGTG 1 cut(s) 11
PspGI CCWGG 1 cut(s) 84
RsaI GTAC 4 cut(s) 116, 120, 255, 424
RsaNI GTAC 4 cut(s) 115, 119, 254, 423
RseI CAYNNNNRTG 1 cut(s) 9
SaqAI TTAA 1 cut(s) 194
Sau3AI GATC 1 cut(s) 164
ScrFI CCNGG 1 cut(s) 86
SetI ASST 8 cut(s) 13, 120, 247, 255, 286, 301, 348, 409
SfaNI GCATC 6 cut(s) 7, 42, 53, 91, 256, 322
SmiMI CAYNNNNRTG 1 cut(s) 9
SmlI CTYRAG 1 cut(s) 56
SmoI CTYRAG 1 cut(s) 56
SnaBI TACGTA 1 cut(s) 118
SphI GCATGC 2 cut(s) 8, 183
Sse9I AATT 4 cut(s) 35, 133, 190, 323
SsiI CCGC 1 cut(s) 389
StyD4I CCNGG 1 cut(s) 84
TaiI ACGT 2 cut(s) 13, 120
TasI AATT 4 cut(s) 35, 133, 190, 323
TfiI GAWTC 1 cut(s) 61
Tru1I TTAA 1 cut(s) 194
Tru9I TTAA 1 cut(s) 194
TscAI CASTG 1 cut(s) 439
TspDTI ATGAA 4 cut(s) 87, 243, 375, 393
TspRI CASTG 1 cut(s) 439
XapI RAATTY 1 cut(s) 133
XceI RCATGY 4 cut(s) 8, 183, 264, 309
Zsp2I ATGCAT 2 cut(s) 6, 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.