RchiOBHm_Chr1g0321941
ERF Family

Transducin WD40 repeat-like superfamily protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
9448398 .. 9449349
952 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55196

Sequence Viewer

Length: 189 bp
ATGGGGTTCGTTAACAACGTTAAGAAGCTTCAACGACGTGAAATCAGTTCCAAGCGTGACCGAGCTATCACTATGAGCGATGCCCGGGAGAGGTTTTACAATATTCATCTCCAGGCTCTACTTAGGATTTGCATTTGGAGCTTTTTTTGTGTGATATTGATACCAATACTTGGAAAGCATGTTGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.35

Weight (kDa)

10.52

Isoelectric Point (pI)

65.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 170
AclI AACGTT 1 cut(s) 18
AfiI CCNNNNNNNGG 2 cut(s) 90, 170
AgsI TTSAA 1 cut(s) 32
AjiI CACGTC 1 cut(s) 38
AjnI CCWGG 1 cut(s) 111
AluBI AGCT 3 cut(s) 28, 65, 141
AluI AGCT 3 cut(s) 28, 65, 141
Ama87I CYCGRG 1 cut(s) 84
AsuC2I CCSGG 2 cut(s) 85, 86
AvaI CYCGRG 1 cut(s) 84
BciT130I CCWGG 1 cut(s) 113
BcnI CCSGG 2 cut(s) 85, 86
Bme1390I CCNGG 3 cut(s) 85, 86, 113
BmeT110I CYCGRG 1 cut(s) 84
BmgBI CACGTC 1 cut(s) 38
BmrFI CCNGG 3 cut(s) 85, 86, 113
BmsI GCATC 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 95
BpuMI CCSGG 2 cut(s) 85, 86
BsaJI CCNNGG 1 cut(s) 84
Bsc4I CCNNNNNNNGG 2 cut(s) 90, 170
BseBI CCWGG 1 cut(s) 113
BseDI CCNNGG 1 cut(s) 84
BseLI CCNNNNNNNGG 2 cut(s) 90, 170
BsiHKCI CYCGRG 1 cut(s) 84
BsiSI CCGG 1 cut(s) 85
BslI CCNNNNNNNGG 2 cut(s) 90, 170
BsoBI CYCGRG 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 84
Bst2UI CCWGG 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 122
BstMWI GCNNNNNNNGC 1 cut(s) 138
BstNI CCWGG 1 cut(s) 113
BstNSI RCATGY 1 cut(s) 182
BstSCI CCNGG 3 cut(s) 83, 84, 111
BtgZI GCGATG 1 cut(s) 93
BtrI CACGTC 1 cut(s) 38
Cfr9I CCCGGG 1 cut(s) 84
CviAII CATG 1 cut(s) 179
CviJI RGCY 4 cut(s) 28, 65, 116, 141
CviKI_1 RGCY 4 cut(s) 28, 65, 116, 141
DdeI CTNAG 1 cut(s) 122
Eco88I CYCGRG 1 cut(s) 84
EcoRII CCWGG 1 cut(s) 111
FaeI CATG 1 cut(s) 182
FaiI YATR 3 cut(s) 74, 180, 187
FatI CATG 1 cut(s) 178
GsuI CTGGAG 1 cut(s) 95
HapII CCGG 1 cut(s) 85
Hin1II CATG 1 cut(s) 182
HincII GTYRAC 1 cut(s) 13
HindII GTYRAC 1 cut(s) 13
HindIII AAGCTT 1 cut(s) 26
HpaI GTTAAC 1 cut(s) 13
HpaII CCGG 1 cut(s) 85
Hpy166II GTNNAC 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 13
Hpy99I CGWCG 1 cut(s) 39
HpyCH4IV ACGT 2 cut(s) 18, 37
HpyCH4V TGCA 1 cut(s) 132
HpyF10VI GCNNNNNNNGC 1 cut(s) 138
HpyF3I CTNAG 1 cut(s) 122
HpySE526I ACGT 2 cut(s) 18, 37
Hsp92II CATG 1 cut(s) 182
KspAI GTTAAC 1 cut(s) 13
LmnI GCTCC 1 cut(s) 138
LpnPI CCDG 3 cut(s) 98, 98, 125
LweI GCATC 1 cut(s) 70
MaeII ACGT 2 cut(s) 18, 37
MaeIII GTNAC 1 cut(s) 56
MnlI CCTC 1 cut(s) 84
MseI TTAA 2 cut(s) 12, 21
MspI CCGG 1 cut(s) 85
MspR9I CCNGG 3 cut(s) 85, 86, 113
MvaI CCWGG 1 cut(s) 113
MwoI GCNNNNNNNGC 1 cut(s) 138
NciI CCSGG 2 cut(s) 85, 86
NlaIII CATG 1 cut(s) 182
NmuCI GTSAC 1 cut(s) 56
NspI RCATGY 1 cut(s) 182
PcsI WCGNNNNNNNCGW 1 cut(s) 15
PflMI CCANNNNNTGG 1 cut(s) 170
Psp1406I AACGTT 1 cut(s) 18
Psp6I CCWGG 1 cut(s) 111
PspGI CCWGG 1 cut(s) 111
SaqAI TTAA 2 cut(s) 12, 21
ScrFI CCNGG 3 cut(s) 85, 86, 113
SetI ASST 6 cut(s) 21, 30, 40, 67, 95, 143
SfaNI GCATC 1 cut(s) 70
SmaI CCCGGG 1 cut(s) 86
SspI AATATT 1 cut(s) 103
StyD4I CCNGG 3 cut(s) 83, 84, 111
TaiI ACGT 2 cut(s) 21, 40
TaqII GACCGA 1 cut(s) 75
Tru1I TTAA 2 cut(s) 12, 21
Tru9I TTAA 2 cut(s) 12, 21
TseFI GTSAC 1 cut(s) 56
Tsp45I GTSAC 1 cut(s) 56
TspDTI ATGAA 1 cut(s) 95
TspMI CCCGGG 1 cut(s) 84
Van91I CCANNNNNTGG 1 cut(s) 170
XceI RCATGY 1 cut(s) 182
XmaI CCCGGG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.