Rh5BG454900
ERF Family

Transducin WD40 repeat-like superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
OG0004873
Physical Location & Seq
Reverse (-)
72901888 .. 72902980
1093 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG454900.1

Sequence Viewer

Length: 199 bp
ATGGAGTTCATTAACAGCGTTAAGAAGCTTCAACGACGTGAAATCAGTTCCAAGCGTGACCGAGCTATCACTATGAGCGATGCCCGGGAGAGGTTTTACAATATTCATCTCCAGTATATACAATACATGGTGTCTGCTCTAAAAACTATACAATGTTGTACTCCATATCAGATAAACATGTCCAAGAAATTAAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.99

Weight (kDa)

10.02

Isoelectric Point (pI)

71.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 160
AfiI CCNNNNNNNGG 1 cut(s) 90
AflIII ACRYGT 1 cut(s) 177
AgsI TTSAA 1 cut(s) 32
AjiI CACGTC 1 cut(s) 38
AluBI AGCT 2 cut(s) 28, 65
AluI AGCT 2 cut(s) 28, 65
Ama87I CYCGRG 1 cut(s) 84
AsuC2I CCSGG 2 cut(s) 85, 86
AvaI CYCGRG 1 cut(s) 84
BcnI CCSGG 2 cut(s) 85, 86
Bme1390I CCNGG 2 cut(s) 85, 86
BmeT110I CYCGRG 1 cut(s) 84
BmgBI CACGTC 1 cut(s) 38
BmrFI CCNGG 2 cut(s) 85, 86
BmsI GCATC 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 95
BpuMI CCSGG 2 cut(s) 85, 86
BsaJI CCNNGG 1 cut(s) 84
Bsc4I CCNNNNNNNGG 1 cut(s) 90
Bse1I ACTGG 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 84
BseLI CCNNNNNNNGG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 112
BsiHKCI CYCGRG 1 cut(s) 84
BsiSI CCGG 1 cut(s) 85
BslI CCNNNNNNNGG 1 cut(s) 90
BsoBI CYCGRG 1 cut(s) 84
BsrI ACTGG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 84
BstNSI RCATGY 1 cut(s) 181
BstSCI CCNGG 2 cut(s) 83, 84
BtgZI GCGATG 1 cut(s) 93
BtrI CACGTC 1 cut(s) 38
Cfr9I CCCGGG 1 cut(s) 84
Csp6I GTAC 1 cut(s) 159
CviAII CATG 2 cut(s) 127, 178
CviJI RGCY 2 cut(s) 28, 65
CviKI_1 RGCY 2 cut(s) 28, 65
CviQI GTAC 1 cut(s) 159
Eco88I CYCGRG 1 cut(s) 84
FaeI CATG 2 cut(s) 130, 181
FaiI YATR 7 cut(s) 74, 117, 119, 128, 149, 166, 179
FatI CATG 2 cut(s) 126, 177
GsuI CTGGAG 1 cut(s) 95
HapII CCGG 1 cut(s) 85
Hin1II CATG 2 cut(s) 130, 181
HindIII AAGCTT 1 cut(s) 26
HpaII CCGG 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 171
Hpy99I CGWCG 1 cut(s) 39
HpyCH4IV ACGT 1 cut(s) 37
HpySE526I ACGT 1 cut(s) 37
Hsp92II CATG 2 cut(s) 130, 181
LpnPI CCDG 2 cut(s) 98, 125
LweI GCATC 1 cut(s) 70
MaeII ACGT 1 cut(s) 37
MaeIII GTNAC 1 cut(s) 56
MluCI AATT 1 cut(s) 188
MnlI CCTC 1 cut(s) 84
MseI TTAA 3 cut(s) 12, 21, 191
MspI CCGG 1 cut(s) 85
MspR9I CCNGG 2 cut(s) 85, 86
NciI CCSGG 2 cut(s) 85, 86
NlaIII CATG 2 cut(s) 130, 181
NmuCI GTSAC 1 cut(s) 56
NspI RCATGY 1 cut(s) 181
PciI ACATGT 1 cut(s) 177
PscI ACATGT 1 cut(s) 177
RsaI GTAC 1 cut(s) 160
RsaNI GTAC 1 cut(s) 159
SaqAI TTAA 3 cut(s) 12, 21, 191
ScrFI CCNGG 2 cut(s) 85, 86
SetI ASST 4 cut(s) 30, 40, 67, 95
SfaNI GCATC 1 cut(s) 70
SmaI CCCGGG 1 cut(s) 86
Sse9I AATT 1 cut(s) 188
SspI AATATT 1 cut(s) 103
StyD4I CCNGG 2 cut(s) 83, 84
TaiI ACGT 1 cut(s) 40
TaqII GACCGA 1 cut(s) 75
TasI AATT 1 cut(s) 188
TatI WGTACW 1 cut(s) 158
Tru1I TTAA 3 cut(s) 12, 21, 191
Tru9I TTAA 3 cut(s) 12, 21, 191
TseFI GTSAC 1 cut(s) 56
Tsp45I GTSAC 1 cut(s) 56
TspDTI ATGAA 1 cut(s) 95
TspMI CCCGGG 1 cut(s) 84
XceI RCATGY 1 cut(s) 181
XmaI CCCGGG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.