RchiOBHm_Chr7g0227301
ERF Family

Transducin WD40 repeat-like superfamily protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0004873
Physical Location & Seq
Reverse (-)
50587897 .. 50589962
2066 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20358

Sequence Viewer

Length: 264 bp
ATGGTTCTGCCTTTTCTGCGAAAGAGGTCGAAAATTATTGAAATTGTGGCAGCACATGACATTGTGTTCGCACTTGCGCAGTCTGGTGTTTGTGCAGCGTTTAGCCGAGAAACCAATCAGAGGATATGCTTTCTGAATGTCAATCTCGACGAAGTTATAAGAAGCCTATTTTATAATAAAAACAATGACTCACTTATCACAGTTTCAGTTTATGCTTCAGACAATTTCAGTTCTTTGAAATGTAGAAGCATAAGGATTAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.88

Weight (kDa)

9.5

Isoelectric Point (pI)

52.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7899 PF25463 2 - 87 3.5e-44 Domain of unknown function (DUF7899)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 158, 174
Acc16I TGCGCA 1 cut(s) 78
AcuI CTGAAG 1 cut(s) 201
AfiI CCNNNNNNNGG 1 cut(s) 120
AgsI TTSAA 2 cut(s) 41, 238
ApeKI GCWGC 2 cut(s) 50, 95
ArsI GACNNNNNNTTYG 2 cut(s) 50, 82
AspLEI GCGC 1 cut(s) 79
BbvI GCAGC 2 cut(s) 62, 107
BisI GCNGC 2 cut(s) 51, 96
BlsI GCNGC 2 cut(s) 52, 97
Bsc4I CCNNNNNNNGG 1 cut(s) 120
BseLI CCNNNNNNNGG 1 cut(s) 120
BseXI GCAGC 2 cut(s) 62, 107
BsgI GTGCAG 1 cut(s) 114
BslI CCNNNNNNNGG 1 cut(s) 120
Bst4CI ACNGT 1 cut(s) 202
BstHHI GCGC 1 cut(s) 79
BstMWI GCNNNNNNNGC 1 cut(s) 16
BstV1I GCAGC 2 cut(s) 62, 107
CfoI GCGC 1 cut(s) 79
CviAII CATG 1 cut(s) 56
CviJI RGCY 2 cut(s) 105, 165
CviKI_1 RGCY 2 cut(s) 105, 165
Eco57I CTGAAG 1 cut(s) 201
FaeI CATG 1 cut(s) 59
FaiI YATR 6 cut(s) 57, 127, 158, 174, 213, 251
FatI CATG 1 cut(s) 55
Fnu4HI GCNGC 2 cut(s) 51, 96
Fsp4HI GCNGC 2 cut(s) 51, 96
FspEI CC 9 cut(s) 10, 24, 32, 69, 106, 119, 127, 179, 238
FspI TGCGCA 1 cut(s) 78
GlaI GCGC 1 cut(s) 78
GluI GCNGC 2 cut(s) 51, 96
HhaI GCGC 1 cut(s) 79
Hin1II CATG 1 cut(s) 59
Hin6I GCGC 1 cut(s) 77
HinP1I GCGC 1 cut(s) 77
HinfI GANTC 1 cut(s) 188
Hpy188I TCNGA 3 cut(s) 120, 135, 220
Hpy188III TCNNGA 1 cut(s) 146
Hpy99I CGWCG 1 cut(s) 152
HpyCH4III ACNGT 1 cut(s) 202
HpyCH4V TGCA 1 cut(s) 95
HpyF10VI GCNNNNNNNGC 1 cut(s) 16
Hsp92II CATG 1 cut(s) 59
HspAI GCGC 1 cut(s) 77
LpnPI CCDG 1 cut(s) 69
Lsp1109I GCAGC 2 cut(s) 62, 107
MluCI AATT 3 cut(s) 33, 42, 223
MlyI GAGTC 1 cut(s) 182
MnlI CCTC 2 cut(s) 18, 114
MseI TTAA 1 cut(s) 258
MwoI GCNNNNNNNGC 1 cut(s) 16
NlaIII CATG 1 cut(s) 59
NmeAIII GCCGAG 1 cut(s) 131
NsbI TGCGCA 1 cut(s) 78
PkrI GCNGC 2 cut(s) 52, 97
PleI GAGTC 1 cut(s) 182
PpsI GAGTC 1 cut(s) 182
PsiI TTATAA 2 cut(s) 158, 174
SaqAI TTAA 1 cut(s) 258
SatI GCNGC 2 cut(s) 51, 96
SchI GAGTC 1 cut(s) 182
SetI ASST 1 cut(s) 29
SgeI CNNG 5 cut(s) 68, 86, 96, 119, 158
Sse9I AATT 3 cut(s) 33, 42, 223
TaaI ACNGT 1 cut(s) 202
TaqI TCGA 2 cut(s) 29, 147
TasI AATT 3 cut(s) 33, 42, 223
Tru1I TTAA 1 cut(s) 258
Tru9I TTAA 1 cut(s) 258
TseI GCWGC 2 cut(s) 50, 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.