Rh5DG469300

Acyl-coenzyme A oxidase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
74460027 .. 74463951
3925 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG469300.1

Sequence Viewer

Length: 303 bp
ATGGGCAGAGCCATAAATGGTGAAAATGTGCTATTGGAGAAGTACTATTTAGTCAGTTATTCATCAAAATTACTAATAAATAATACATTTTTCTTTGACATCAGAGTAATTTCTAAAGCAGTGGAATATTTTAGGTTTTTAACACAGGTCAGCAAGGCACTTCTTGCAAAGTTTATGATAGCTCAAAAGAGAAGCAAACCATTTAAAGCTTTGGGATCAGAACATATGAATAAACCTTCCCCTGTCATTCCATCTAACCTTACAAGTTCTACTCTCCAAAGTCTCGAATTTCAGGTGATATAG

Protein Analysis

100

Amino Acids

11.39

Weight (kDa)

9.93

Isoelectric Point (pI)

38.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 223
AcsI RAATTY 1 cut(s) 287
AfaI GTAC 1 cut(s) 44
AluBI AGCT 2 cut(s) 182, 209
AluI AGCT 2 cut(s) 182, 209
Alw26I GTCTC 1 cut(s) 287
AlwI GGATC 1 cut(s) 223
ApoI RAATTY 1 cut(s) 287
AsuHPI GGTGA 1 cut(s) 32
BccI CCATC 1 cut(s) 259
BcoDI GTCTC 1 cut(s) 287
BmcAI AGTACT 1 cut(s) 44
BsmAI GTCTC 1 cut(s) 287
Bsp143I GATC 1 cut(s) 215
BspPI GGATC 1 cut(s) 223
BssMI GATC 1 cut(s) 215
BstAPI GCANNNNNTGC 1 cut(s) 164
BstKTI GATC 1 cut(s) 218
BstMAI GTCTC 1 cut(s) 287
BstMBI GATC 1 cut(s) 215
BstMWI GCNNNNNNNGC 1 cut(s) 164
BtsI GCAGTG 1 cut(s) 126
BtsIMutI CAGTG 1 cut(s) 126
Csp6I GTAC 1 cut(s) 43
CviJI RGCY 3 cut(s) 11, 182, 209
CviKI_1 RGCY 3 cut(s) 11, 182, 209
CviQI GTAC 1 cut(s) 43
DpnI GATC 1 cut(s) 217
DpnII GATC 1 cut(s) 215
DraI TTTAAA 1 cut(s) 205
FaiI YATR 5 cut(s) 14, 176, 225, 227, 301
FauNDI CATATG 1 cut(s) 225
HindIII AAGCTT 1 cut(s) 207
HphI GGTGA 1 cut(s) 32
Hpy188I TCNGA 2 cut(s) 104, 220
Hpy188III TCNNGA 1 cut(s) 284
HpyAV CCTTC 1 cut(s) 246
HpyCH4V TGCA 1 cut(s) 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
Kzo9I GATC 1 cut(s) 215
LpnPI CCDG 3 cut(s) 131, 255, 278
MalI GATC 1 cut(s) 217
MboI GATC 1 cut(s) 215
MluCI AATT 3 cut(s) 68, 108, 287
MseI TTAA 2 cut(s) 140, 204
MwoI GCNNNNNNNGC 1 cut(s) 164
NdeI CATATG 1 cut(s) 225
NdeII GATC 1 cut(s) 215
RsaI GTAC 1 cut(s) 44
RsaNI GTAC 1 cut(s) 43
SaqAI TTAA 2 cut(s) 140, 204
Sau3AI GATC 1 cut(s) 215
ScaI AGTACT 1 cut(s) 44
SetI ASST 7 cut(s) 137, 150, 184, 211, 238, 261, 297
SgeI CNNG 6 cut(s) 158, 166, 176, 254, 276, 296
Sse9I AATT 3 cut(s) 68, 108, 287
SspI AATATT 1 cut(s) 128
TaqI TCGA 1 cut(s) 285
TasI AATT 3 cut(s) 68, 108, 287
TatI WGTACW 1 cut(s) 42
Tru1I TTAA 2 cut(s) 140, 204
Tru9I TTAA 2 cut(s) 140, 204
TscAI CASTG 1 cut(s) 126
TspDTI ATGAA 2 cut(s) 51, 242
TspRI CASTG 1 cut(s) 126
XapI RAATTY 1 cut(s) 287
ZrmI AGTACT 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.