RchiOBHm_Chr1g0363451

Catalytic subunit of the peripheral V1 complex of vacuolar ATPase (V-ATPase). V-ATPase is responsible for acidifying a variety of intracellular compartments in eukaryotic cells

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
54848012 .. 54848776
765 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58820

Sequence Viewer

Length: 324 bp
ATGGAAGTCATCAACAAACATAACACAGTTCAACAGCTACTAACTGTGGAGCAAGAAGTTCAGCAGATTTTGAATGCTTCCAGAAATGCTAAAACGGCTAAACTAAAACAAGCTAAAGAGGAAGCTGAGAAGGAGAATGCTGATTTCCATGCTCAAATGGAAGTTGACTTTCAGAGAAAACATGCAGAGGGAGGTGGACATTCAGGTCCTCTGAAGAGAATTGAGCAAGAGACAGAGGCCTTCCATCATTTGAAGATTGATGCTGCAAGAATATCAAATGACATTGTGCGGATGCTTTTGGAATATACAACTGTGACCAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.22

Weight (kDa)

6.05

Isoelectric Point (pI)

34.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
V-ATPase_G PF03179 6 - 104 1.6e-18 Vacuolar (H+)-ATPase G subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 204
AciI CCGC 1 cut(s) 289
AcuI CTGAAG 1 cut(s) 233
AgsI TTSAA 3 cut(s) 32, 73, 253
AluBI AGCT 3 cut(s) 37, 113, 125
AluI AGCT 3 cut(s) 37, 113, 125
Alw26I GTCTC 1 cut(s) 224
AoxI GGCC 1 cut(s) 237
ApeKI GCWGC 1 cut(s) 263
AspS9I GGNCC 1 cut(s) 206
AvaII GGWCC 1 cut(s) 206
BbvI GCAGC 1 cut(s) 250
BccI CCATC 1 cut(s) 252
BceAI ACGGC 1 cut(s) 111
BcoDI GTCTC 1 cut(s) 224
BisI GCNGC 1 cut(s) 264
BlsI GCNGC 1 cut(s) 265
Bme18I GGWCC 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 206
BmsI GCATC 2 cut(s) 250, 282
BseGI GGATG 1 cut(s) 297
BseMII CTCAG 1 cut(s) 117
BseXI GCAGC 1 cut(s) 250
BshFI GGCC 1 cut(s) 239
BsmAI GTCTC 1 cut(s) 224
BsmI GAATGC 2 cut(s) 79, 142
BsnI GGCC 1 cut(s) 239
BspACI CCGC 1 cut(s) 289
BspANI GGCC 1 cut(s) 239
BspCNI CTCAG 1 cut(s) 118
Bst4CI ACNGT 3 cut(s) 28, 46, 313
Bst6I CTCTTC 1 cut(s) 209
BstDEI CTNAG 1 cut(s) 126
BstF5I GGATG 1 cut(s) 297
BstMAI GTCTC 1 cut(s) 224
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstNSI RCATGY 1 cut(s) 185
BstV1I GCAGC 1 cut(s) 250
BsuRI GGCC 1 cut(s) 239
BtsCI GGATG 1 cut(s) 297
Cfr13I GGNCC 1 cut(s) 206
CviAII CATG 2 cut(s) 149, 182
CviJI RGCY 5 cut(s) 37, 98, 113, 125, 239
CviKI_1 RGCY 5 cut(s) 37, 98, 113, 125, 239
DdeI CTNAG 1 cut(s) 126
DrdI GACNNNNNNGTC 1 cut(s) 204
DseDI GACNNNNNNGTC 1 cut(s) 204
Eam1104I CTCTTC 1 cut(s) 209
EarI CTCTTC 1 cut(s) 209
Eco147I AGGCCT 1 cut(s) 239
Eco47I GGWCC 1 cut(s) 206
Eco57I CTGAAG 1 cut(s) 233
EcoO109I RGGNCCY 1 cut(s) 206
FaeI CATG 2 cut(s) 152, 185
FaiI YATR 4 cut(s) 21, 150, 183, 306
FatI CATG 2 cut(s) 148, 181
Fnu4HI GCNGC 1 cut(s) 264
FokI GGATG 1 cut(s) 304
Fsp4HI GCNGC 1 cut(s) 264
GluI GCNGC 1 cut(s) 264
HaeIII GGCC 1 cut(s) 239
Hin1II CATG 2 cut(s) 152, 185
HincII GTYRAC 1 cut(s) 166
HindII GTYRAC 1 cut(s) 166
Hpy166II GTNNAC 2 cut(s) 166, 197
Hpy188I TCNGA 2 cut(s) 174, 213
Hpy188III TCNNGA 1 cut(s) 81
Hpy8I GTNNAC 2 cut(s) 166, 197
HpyAV CCTTC 2 cut(s) 124, 250
HpyCH4III ACNGT 3 cut(s) 28, 46, 313
HpyCH4V TGCA 2 cut(s) 185, 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 126
Hsp92II CATG 2 cut(s) 152, 185
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 2 cut(s) 94, 189
Lsp1109I GCAGC 1 cut(s) 250
LweI GCATC 2 cut(s) 250, 282
MaeIII GTNAC 1 cut(s) 313
MboII GAAGA 2 cut(s) 226, 265
MluCI AATT 1 cut(s) 219
MnlI CCTC 5 cut(s) 112, 181, 185, 219, 229
Mva1269I GAATGC 2 cut(s) 79, 142
MwoI GCNNNNNNNGC 1 cut(s) 95
NlaIII CATG 2 cut(s) 152, 185
NmuCI GTSAC 1 cut(s) 313
NspI RCATGY 1 cut(s) 185
PceI AGGCCT 1 cut(s) 239
PctI GAATGC 2 cut(s) 79, 142
PkrI GCNGC 1 cut(s) 265
PpuMI RGGWCCY 1 cut(s) 206
Psp5II RGGWCCY 1 cut(s) 206
PspPI GGNCC 1 cut(s) 206
PspPPI RGGWCCY 1 cut(s) 206
SatI GCNGC 1 cut(s) 264
Sau96I GGNCC 1 cut(s) 206
SetI ASST 5 cut(s) 39, 115, 127, 196, 208
SfaNI GCATC 2 cut(s) 250, 282
SgeI CNNG 8 cut(s) 65, 93, 122, 161, 194, 216, 239, 279
SinI GGWCC 1 cut(s) 206
Sse9I AATT 1 cut(s) 219
SseBI AGGCCT 1 cut(s) 239
SsiI CCGC 1 cut(s) 289
StuI AGGCCT 1 cut(s) 239
TaaI ACNGT 3 cut(s) 28, 46, 313
TasI AATT 1 cut(s) 219
TseFI GTSAC 1 cut(s) 313
TseI GCWGC 1 cut(s) 263
Tsp45I GTSAC 1 cut(s) 313
VpaK11BI GGWCC 1 cut(s) 206
XceI RCATGY 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.